Incidental Mutation 'R0699:Abcb6'
ID218728
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms1200005B17Rik
MMRRC Submission 038883-MU
Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R0699 (G1)
Quality Score70
Status Validated
Chromosome1
Chromosomal Location75171717-75180392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75171909 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 89 (E89K)
Ref Sequence ENSEMBL: ENSMUSP00000124630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027394] [ENSMUST00000027396] [ENSMUST00000160439] [ENSMUST00000161215] [ENSMUST00000162768]
Predicted Effect probably benign
Transcript: ENSMUST00000027394
SMART Domains Protein: ENSMUSP00000027394
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027396
AA Change: E834K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: E834K

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160282
Predicted Effect probably benign
Transcript: ENSMUST00000160439
SMART Domains Protein: ENSMUSP00000125086
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161106
Predicted Effect probably damaging
Transcript: ENSMUST00000161215
AA Change: E89K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198
AA Change: E89K

DomainStartEndE-ValueType
SCOP:d1jj7a_ 5 78 8e-23 SMART
Blast:AAA 23 71 9e-25 BLAST
PDB:3NHB|A 23 94 3e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161657
Predicted Effect probably benign
Transcript: ENSMUST00000162768
SMART Domains Protein: ENSMUSP00000124552
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186227
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75178002 missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75172111 unclassified probably benign
R0035:Abcb6 UTSW 1 75175007 missense possibly damaging 0.74
R1470:Abcb6 UTSW 1 75172679 unclassified probably benign
R1595:Abcb6 UTSW 1 75177300 unclassified probably null
R1912:Abcb6 UTSW 1 75179955 missense probably benign
R2078:Abcb6 UTSW 1 75172136 missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75175043 unclassified probably benign
R4015:Abcb6 UTSW 1 75174491 unclassified probably null
R4604:Abcb6 UTSW 1 75179877 missense probably benign
R4633:Abcb6 UTSW 1 75177782 unclassified probably benign
R4748:Abcb6 UTSW 1 75177358 missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75177912 unclassified probably benign
R5654:Abcb6 UTSW 1 75174835 unclassified probably null
R5841:Abcb6 UTSW 1 75174350 missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75172551 splice site probably null
R6527:Abcb6 UTSW 1 75177488 critical splice acceptor site probably null
X0009:Abcb6 UTSW 1 75174553 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCGCAGGCCATTTATTTCCTCACG -3'
(R):5'- CCATCGTCATAGCACACAGGTACAG -3'

Sequencing Primer
(F):5'- ATTTCCTCACGATGCTTTCTGG -3'
(R):5'- TCATCAAGGACGGTTGCATC -3'
Posted On2014-08-20