Incidental Mutation 'R0135:Retsat'
ID21876
Institutional Source Beutler Lab
Gene Symbol Retsat
Ensembl Gene ENSMUSG00000056666
Gene Nameretinol saturase (all trans retinol 13,14 reductase)
Synonyms
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location72598475-72608425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72602772 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 177 (T177A)
Ref Sequence ENSEMBL: ENSMUSP00000134847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070597] [ENSMUST00000070990] [ENSMUST00000114069] [ENSMUST00000141833] [ENSMUST00000148108] [ENSMUST00000152705] [ENSMUST00000176168] [ENSMUST00000176364]
Predicted Effect probably benign
Transcript: ENSMUST00000070597
AA Change: T238A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068568
Gene: ENSMUSG00000056666
AA Change: T238A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:FAD_binding_2 68 113 8.9e-9 PFAM
Pfam:NAD_binding_8 71 136 1.3e-15 PFAM
Pfam:Amino_oxidase 76 587 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070990
SMART Domains Protein: ENSMUSP00000067768
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 151 314 3.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114069
SMART Domains Protein: ENSMUSP00000109703
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 154 313 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129071
Predicted Effect probably benign
Transcript: ENSMUST00000141833
Predicted Effect probably benign
Transcript: ENSMUST00000148108
Predicted Effect probably benign
Transcript: ENSMUST00000152705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175824
Predicted Effect probably benign
Transcript: ENSMUST00000176168
SMART Domains Protein: ENSMUSP00000135421
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1gpea1 95 175 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176364
AA Change: T177A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134847
Gene: ENSMUSG00000056666
AA Change: T177A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1d5ta1 91 290 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206112
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are deficient in the production of all-trans-13,14-dihydroretinol from dietary vitamin A and exhibit increased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Retsat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Retsat APN 6 72607317 missense probably damaging 1.00
IGL01816:Retsat APN 6 72601605 missense probably benign 0.02
IGL01993:Retsat APN 6 72604995 unclassified probably benign
IGL02212:Retsat APN 6 72601710 nonsense probably null
IGL02719:Retsat APN 6 72603659 missense possibly damaging 0.94
IGL02870:Retsat APN 6 72607024 missense probably damaging 1.00
IGL03352:Retsat APN 6 72598683 missense probably damaging 0.96
R0487:Retsat UTSW 6 72606431 missense probably damaging 0.96
R1173:Retsat UTSW 6 72603651 unclassified probably benign
R1716:Retsat UTSW 6 72606080 missense probably damaging 0.99
R1718:Retsat UTSW 6 72602671 missense probably benign 0.00
R1744:Retsat UTSW 6 72606575 nonsense probably null
R4976:Retsat UTSW 6 72601626 missense probably damaging 1.00
R5434:Retsat UTSW 6 72601535 missense probably damaging 0.96
R5669:Retsat UTSW 6 72606010 missense probably benign 0.02
R6247:Retsat UTSW 6 72604935 missense probably benign 0.06
R6675:Retsat UTSW 6 72601689 missense probably benign 0.00
R7200:Retsat UTSW 6 72606019 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCCCAGAGCTGAGACTCACTTTAC -3'
(R):5'- CCTGGATTTGATCTCCAGCACCAC -3'

Sequencing Primer
(F):5'- ACCTTTTTTATCCCAGGTGGTG -3'
(R):5'- aggaaggtagaggcagaagg -3'
Posted On2013-04-12