Incidental Mutation 'R0699:Trmt2a'
ID218766
Institutional Source Beutler Lab
Gene Symbol Trmt2a
Ensembl Gene ENSMUSG00000022721
Gene NameTRM2 tRNA methyltransferase 2A
SynonymsHtf9c
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R0699 (G1)
Quality Score53
Status Validated
Chromosome16
Chromosomal Location18248679-18254772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18249529 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000111304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect probably benign
Transcript: ENSMUST00000009321
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably benign
Transcript: ENSMUST00000100099
AA Change: V22A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721
AA Change: V22A

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115640
AA Change: V22A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721
AA Change: V22A

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115645
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect probably benign
Transcript: ENSMUST00000140206
AA Change: V22A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721
AA Change: V22A

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232015
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232342
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Trmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trmt2a APN 16 18249487 missense probably benign
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0377:Trmt2a UTSW 16 18249703 missense possibly damaging 0.68
R1034:Trmt2a UTSW 16 18249709 missense probably damaging 1.00
R1114:Trmt2a UTSW 16 18250440 unclassified probably benign
R1882:Trmt2a UTSW 16 18249894 missense possibly damaging 0.88
R1911:Trmt2a UTSW 16 18251206 missense probably benign 0.01
R2184:Trmt2a UTSW 16 18252995 missense probably benign 0.06
R3853:Trmt2a UTSW 16 18251191 missense possibly damaging 0.94
R4427:Trmt2a UTSW 16 18249229 unclassified probably benign
R4737:Trmt2a UTSW 16 18251286 unclassified probably benign
R4896:Trmt2a UTSW 16 18252929 missense probably damaging 0.99
R4903:Trmt2a UTSW 16 18249554 nonsense probably null
R4964:Trmt2a UTSW 16 18249554 nonsense probably null
R4966:Trmt2a UTSW 16 18249554 nonsense probably null
R5216:Trmt2a UTSW 16 18252184 missense probably benign 0.22
R5452:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R5837:Trmt2a UTSW 16 18249462 unclassified probably benign
R6555:Trmt2a UTSW 16 18253203 missense probably benign 0.03
R6670:Trmt2a UTSW 16 18250477 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AAAGAACGGGTTTCTCCAGGGC -3'
(R):5'- CGGAATGTTACAAAGGCACATGGTG -3'

Sequencing Primer
(F):5'- TTTCTCCAGGGCTTCGTG -3'
(R):5'- TTTGTGGGACTGTAGACCAAAAC -3'
Posted On2014-08-20