Incidental Mutation 'R0722:Lrrc8c'
ID218776
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 038904-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0722 (G1)
Quality Score50
Status Validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105579548 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 26 (V26E)
Ref Sequence ENSEMBL: ENSMUSP00000114899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000150981] [ENSMUST00000153754]
Predicted Effect probably damaging
Transcript: ENSMUST00000067924
AA Change: V26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: V26E

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150195
Predicted Effect probably damaging
Transcript: ENSMUST00000150981
AA Change: V26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000153754
AA Change: V26E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720
AA Change: V26E

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Clpp T C 17: 56,992,901 V144A probably damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Ermard A G 17: 15,022,128 T189A probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Heatr1 A G 13: 12,406,037 E403G probably benign Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Htr1f A G 16: 64,925,891 I346T probably damaging Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Pld5 A G 1: 175,975,515 F395L probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R7271:Lrrc8c UTSW 5 105607987 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGGAACATCATCTTGGCAGC -3'
(R):5'- AACCATCTCTTGGGCAAGTGGC -3'

Sequencing Primer
(F):5'- TGTGGCTTCAGAAGACCCTG -3'
(R):5'- tgaacccagggcctcac -3'
Posted On2014-08-20