Incidental Mutation 'R0722:Heatr1'
ID218781
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 038904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R0722 (G1)
Quality Score56
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12406037 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 403 (E403G)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: E403G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: E403G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221046
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Clpp T C 17: 56,992,901 V144A probably damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Ermard A G 17: 15,022,128 T189A probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Htr1f A G 16: 64,925,891 I346T probably damaging Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Lrrc8c T A 5: 105,579,548 V26E probably damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Pld5 A G 1: 175,975,515 F395L probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTTTAAACCTTAAAGCCCTGTCC -3'
(R):5'- AGTCACACGTCATCAGTCCTCCTG -3'

Sequencing Primer
(F):5'- tttgacctcagacaaattggaag -3'
(R):5'- GTCATCAGTCCTCCTGACAGAG -3'
Posted On2014-08-20