Incidental Mutation 'R0722:Clpp'
ID218785
Institutional Source Beutler Lab
Gene Symbol Clpp
Ensembl Gene ENSMUSG00000002660
Gene Namecaseinolytic mitochondrial matrix peptidase proteolytic subunit
SynonymsD17Wsu160e
MMRRC Submission 038904-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R0722 (G1)
Quality Score27
Status Validated
Chromosome17
Chromosomal Location56990264-56996371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56992901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000002735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002735] [ENSMUST00000002737] [ENSMUST00000074141]
Predicted Effect probably damaging
Transcript: ENSMUST00000002735
AA Change: V144A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002735
Gene: ENSMUSG00000002660
AA Change: V144A

DomainStartEndE-ValueType
Pfam:CLP_protease 63 244 8.8e-82 PFAM
low complexity region 259 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002737
SMART Domains Protein: ENSMUSP00000002737
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 64 203 8.2e-14 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074141
SMART Domains Protein: ENSMUSP00000073775
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 63 145 3.8e-12 PFAM
low complexity region 148 161 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit infertility, hearing loss, growth retardation, reduced activity, T cell activation, increased mitochondrial DNA and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Ermard A G 17: 15,022,128 T189A probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Heatr1 A G 13: 12,406,037 E403G probably benign Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Htr1f A G 16: 64,925,891 I346T probably damaging Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Lrrc8c T A 5: 105,579,548 V26E probably damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Pld5 A G 1: 175,975,515 F395L probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Clpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1891:Clpp UTSW 17 56991307 missense probably damaging 0.99
R1950:Clpp UTSW 17 56996039 unclassified probably benign
R7089:Clpp UTSW 17 56990421 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACAACATTTGCCCTTGTGGCTTG -3'
(R):5'- ATTTCCTCTGCCTGGATGGCGATG -3'

Sequencing Primer
(F):5'- CCTTGTGGCTTGCTGGAAG -3'
(R):5'- agcctgtctctgcctctg -3'
Posted On2014-08-20