Incidental Mutation 'R0726:Smarca2'
ID218891
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 038908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0726 (G1)
Quality Score58
Status Validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26698403 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1014 (K1014N)
Ref Sequence ENSEMBL: ENSMUSP00000135017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025862
AA Change: K1072N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: K1072N

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099537
AA Change: K1072N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: K1072N

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175935
Predicted Effect possibly damaging
Transcript: ENSMUST00000176030
AA Change: K1072N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: K1072N

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176769
AA Change: K1014N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: K1014N

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208378
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kif15 C A 9: 122,959,928 H62N probably benign Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Rif1 C T 2: 52,110,353 T1273M possibly damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Sntb1 T C 15: 55,676,356 R361G probably benign Het
Soga1 G T 2: 157,060,262 R278S probably damaging Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Usp28 C T 9: 49,003,869 R115C probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATGGTTTAGGAGCTGGTATCCAC -3'
(R):5'- GGCACAGAGGACACTAATTTGCCAC -3'

Sequencing Primer
(F):5'- CAGCCACAGTTCCTTATTGAATG -3'
(R):5'- TGCAGGCCCACTTCTCAAC -3'
Posted On2014-08-22