Incidental Mutation 'R1966:Trpm8'
ID218902
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Nametransient receptor potential cation channel, subfamily M, member 8
SynonymsCMR1, Trp-p8, TRPP8
MMRRC Submission 039979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1966 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88277661-88389293 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 88332748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
Predicted Effect probably null
Transcript: ENSMUST00000040210
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113114
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171176
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
2410002F23Rik T A 7: 44,251,226 V185E probably benign Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cacna2d1 C T 5: 16,333,785 R581* probably null Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lama5 C A 2: 180,188,352 C1896F probably damaging Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nf1 T A 11: 79,411,564 S319R possibly damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Ticrr C A 7: 79,694,735 C1449* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88379827 missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88343287 missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88326405 missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88325488 missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88330694 critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88328250 missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88360716 missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88348051 missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88348108 missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88328148 splice site probably benign
R1183:Trpm8 UTSW 1 88348091 missense probably damaging 1.00
R1608:Trpm8 UTSW 1 88326432 missense probably benign
R1713:Trpm8 UTSW 1 88365080 missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88350856 missense possibly damaging 0.86
R2089:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88359656 missense probably benign 0.00
R2475:Trpm8 UTSW 1 88354449 missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88328196 missense probably benign 0.00
R3745:Trpm8 UTSW 1 88348327 missense probably benign 0.21
R4063:Trpm8 UTSW 1 88362005 missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88337129 missense probably benign 0.07
R4681:Trpm8 UTSW 1 88384705 missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88348188 missense probably benign 0.00
R5620:Trpm8 UTSW 1 88359651 critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88359739 missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88355280 missense probably benign 0.01
R5839:Trpm8 UTSW 1 88325506 missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88384711 makesense probably null
R5845:Trpm8 UTSW 1 88328180 missense probably benign 0.00
R5926:Trpm8 UTSW 1 88330747 missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88351415 nonsense probably null
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88306678 start gained probably benign
R6283:Trpm8 UTSW 1 88348332 missense probably benign 0.09
R6299:Trpm8 UTSW 1 88354479 missense probably damaging 1.00
R6367:Trpm8 UTSW 1 88359683 missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88361998 missense probably damaging 0.98
R6682:Trpm8 UTSW 1 88326502 missense probably damaging 0.96
R6751:Trpm8 UTSW 1 88384706 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGGTGCATGGCGATTCATTC -3'
(R):5'- AGGGAGTTGTGTACTGAACG -3'

Sequencing Primer
(F):5'- GAGATCTATCCCTTCAAGGTCAAGG -3'
(R):5'- TGTGTACTGAACGTGGGGAAAGTAC -3'
Posted On2014-08-25