Incidental Mutation 'R1966:Lama5'
ID218923
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 039979-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1966 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 180188352 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1896 (C1896F)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015791
AA Change: C1896F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: C1896F

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
2410002F23Rik T A 7: 44,251,226 V185E probably benign Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cacna2d1 C T 5: 16,333,785 R581* probably null Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nf1 T A 11: 79,411,564 S319R possibly damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Ticrr C A 7: 79,694,735 C1449* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Trpm8 T A 1: 88,332,748 probably null Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCCCACCAGCTACATCAGG -3'
(R):5'- AGGGCCTATGGTTCCAGATAAAC -3'

Sequencing Primer
(F):5'- AGCTACATCAGGGCTGGTAC -3'
(R):5'- GCCTATGGTTCCAGATAAACTCAGAC -3'
Posted On2014-08-25