Incidental Mutation 'R1966:Cacna2d1'
ID218939
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 039979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1966 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 16333785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 581 (R581*)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably null
Transcript: ENSMUST00000039370
AA Change: R605*
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: R605*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078272
AA Change: R586*
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: R586*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101581
AA Change: R586*
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: R586*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115281
AA Change: R581*
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: R581*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167946
AA Change: R586*
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: R586*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180204
AA Change: R581*
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: R581*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199704
AA Change: R581*
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: R581*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200294
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
2410002F23Rik T A 7: 44,251,226 V185E probably benign Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lama5 C A 2: 180,188,352 C1896F probably damaging Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nf1 T A 11: 79,411,564 S319R possibly damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Ticrr C A 7: 79,694,735 C1449* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Trpm8 T A 1: 88,332,748 probably null Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 intron probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 unclassified probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCATCATTCTTAAACATGCTCTAC -3'
(R):5'- AATTCATTTCTCTGTTGCAGGG -3'

Sequencing Primer
(F):5'- TTGAGTACTTAGTTCTGTTCCAAAC -3'
(R):5'- GCAGGGAGTCATTTTTCCATTG -3'
Posted On2014-08-25