Incidental Mutation 'R1966:Ticrr'
ID218954
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
MMRRC Submission 039979-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1966 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 79694735 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1449 (C1449*)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: C1449*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: C1449*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
2410002F23Rik T A 7: 44,251,226 V185E probably benign Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cacna2d1 C T 5: 16,333,785 R581* probably null Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lama5 C A 2: 180,188,352 C1896F probably damaging Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nf1 T A 11: 79,411,564 S319R possibly damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Trpm8 T A 1: 88,332,748 probably null Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 unclassified probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAAGAAGTCCTGTCCTCCTCAG -3'
(R):5'- TGAGCAGCATCTTGCCTCTG -3'

Sequencing Primer
(F):5'- TCCTCAGGACTTCCCAGAGTG -3'
(R):5'- TGTACAGCACAGGGGGTAG -3'
Posted On2014-08-25