Incidental Mutation 'R1966:Nf1'
ID218979
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 039979-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1966 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79411564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 319 (S319R)
Ref Sequence ENSEMBL: ENSMUSP00000103886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071325
AA Change: S319R

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: S319R

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108251
AA Change: S319R

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: S319R

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131800
Predicted Effect possibly damaging
Transcript: ENSMUST00000219057
AA Change: S319R

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
2410002F23Rik T A 7: 44,251,226 V185E probably benign Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cacna2d1 C T 5: 16,333,785 R581* probably null Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lama5 C A 2: 180,188,352 C1896F probably damaging Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Ticrr C A 7: 79,694,735 C1449* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Trpm8 T A 1: 88,332,748 probably null Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCTAATGATTAAGCTTCAAAGG -3'
(R):5'- AAAGCAGGTCCTCTGAACAC -3'

Sequencing Primer
(F):5'- TGATAGCCAAATACAAGCCATTTG -3'
(R):5'- GGTCCTCTGAACACAACATCTAAG -3'
Posted On2014-08-25