Incidental Mutation 'R1967:Prr14l'
ID219036
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
MMRRC Submission 039980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1967 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 32844469 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000130134]
Predicted Effect unknown
Transcript: ENSMUST00000120129
AA Change: S16P
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: S16P

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130134
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Greb1l A C 18: 10,501,049 N393T possibly damaging Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Kcng4 A G 8: 119,632,923 V238A probably damaging Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rnf213 T C 11: 119,480,895 V4842A probably damaging Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Slc29a3 A G 10: 60,716,464 V267A probably benign Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Utp20 A G 10: 88,816,979 S358P probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 unclassified probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATGAGTCCTCTGCAAC -3'
(R):5'- CATTTGGTGTCCAATAATGCTGAC -3'

Sequencing Primer
(F):5'- TGAGTCCTCTGCAACCCCAG -3'
(R):5'- CCTACCGGGTGCTAGTATTAAAG -3'
Posted On2014-08-25