Incidental Mutation 'R1967:Utp20'
ID219077
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 039980-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R1967 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88816979 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: S358P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: S358P

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Greb1l A C 18: 10,501,049 N393T possibly damaging Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Kcng4 A G 8: 119,632,923 V238A probably damaging Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Prr14l A G 5: 32,844,469 probably benign Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rnf213 T C 11: 119,480,895 V4842A probably damaging Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Slc29a3 A G 10: 60,716,464 V267A probably benign Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAATCCCTTGAAGGCAGAGC -3'
(R):5'- CCAAGTCTGATATGCCTGAGAG -3'

Sequencing Primer
(F):5'- GCTTCATCTGTATACGCAGCAGAC -3'
(R):5'- GATATGCCTGAGAGCTTGTTAAAAG -3'
Posted On2014-08-25