Incidental Mutation 'R1967:Rnf213'
ID219091
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 039980-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1967 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119480895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 4842 (V4842A)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]
Predicted Effect probably damaging
Transcript: ENSMUST00000093902
AA Change: V4842A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: V4842A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: V4841A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: V4841A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172235
AA Change: V2A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Greb1l A C 18: 10,501,049 N393T possibly damaging Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Kcng4 A G 8: 119,632,923 V238A probably damaging Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Prr14l A G 5: 32,844,469 probably benign Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Slc29a3 A G 10: 60,716,464 V267A probably benign Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Utp20 A G 10: 88,816,979 S358P probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TACAGCTAAGACTGCATGGTGC -3'
(R):5'- CCAGCCTGTATGGTCTGAAC -3'

Sequencing Primer
(F):5'- CAGCTTACCTGTCTGTTAAGGAATG -3'
(R):5'- TCTGAACAGGTGTAGGCTGCAC -3'
Posted On2014-08-25