Incidental Mutation 'R1968:Atp1a4'
ID219152
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene NameATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172223513-172258414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172240164 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 511 (E511K)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
Predicted Effect probably benign
Transcript: ENSMUST00000111243
AA Change: E511K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: E511K

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191616
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172234477 missense probably benign
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172234431 missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172227170 missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172244408 missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTAATGGTGTCCTTTCAAAGCCC -3'
(R):5'- CTGTGCAAATGAAGGGGCTG -3'

Sequencing Primer
(F):5'- TCAAAGCCCTCTCCCTGG -3'
(R):5'- ACTAGCTTGGTGGAAGGT -3'
Posted On2014-08-25