Incidental Mutation 'R0135:Glp1r'
ID21917
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Nameglucagon-like peptide 1 receptor
SynonymsGLP-1R, GLP1Rc
MMRRC Submission 038420-MU
Accession Numbers

Genbank: NM_021332; MGI: 99571

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location30901867-30936510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30924577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 196 (I196V)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
Predicted Effect probably benign
Transcript: ENSMUST00000114574
AA Change: I196V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: I196V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 30901917 missense possibly damaging 0.96
IGL00516:Glp1r APN 17 30925558 missense probably damaging 1.00
IGL00653:Glp1r APN 17 30930760 missense probably damaging 1.00
IGL00917:Glp1r APN 17 30919469 splice site probably benign
IGL02005:Glp1r APN 17 30924611 missense probably benign 0.03
IGL02411:Glp1r APN 17 30924511 missense probably damaging 1.00
IGL02889:Glp1r APN 17 30931144 splice site probably benign
IGL02928:Glp1r APN 17 30918937 missense probably benign 0.00
N/A:Glp1r UTSW 17 30931283 missense probably damaging 0.98
R0395:Glp1r UTSW 17 30936338 missense probably benign 0.34
R0481:Glp1r UTSW 17 30931217 missense probably benign 0.03
R0602:Glp1r UTSW 17 30909227 missense probably benign 0.12
R0841:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1232:Glp1r UTSW 17 30918931 missense probably benign
R1804:Glp1r UTSW 17 30930713 splice site probably null
R1846:Glp1r UTSW 17 30929935 critical splice acceptor site probably null
R1982:Glp1r UTSW 17 30925627 nonsense probably null
R1990:Glp1r UTSW 17 30930748 missense possibly damaging 0.53
R2091:Glp1r UTSW 17 30925549 missense probably damaging 0.97
R3432:Glp1r UTSW 17 30924557 missense probably damaging 1.00
R4456:Glp1r UTSW 17 30918975 nonsense probably null
R4488:Glp1r UTSW 17 30918931 missense probably benign
R4610:Glp1r UTSW 17 30931247 missense probably benign 0.03
R4884:Glp1r UTSW 17 30936266 missense probably damaging 1.00
R5055:Glp1r UTSW 17 30918887 missense probably benign
R6358:Glp1r UTSW 17 30932644 missense probably benign 0.07
R6359:Glp1r UTSW 17 30929972 missense probably damaging 1.00
R6490:Glp1r UTSW 17 30924572 missense probably damaging 0.98
R6698:Glp1r UTSW 17 30936401 missense probably damaging 1.00
R7063:Glp1r UTSW 17 30925558 missense probably damaging 1.00
R7165:Glp1r UTSW 17 30909323 missense probably benign 0.23
R7293:Glp1r UTSW 17 30924625 missense probably benign 0.00
X0064:Glp1r UTSW 17 30919463 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCAGGGCATCAGAGATTTTCAAG -3'
(R):5'- TCCCTAAGGTCACATCTGGGCTAC -3'

Sequencing Primer
(F):5'- TATTCCCAGAGGTGGATACATGC -3'
(R):5'- TAAGGTCACATCTGGGCTACTTTTG -3'
Posted On2013-04-12