Incidental Mutation 'R2009:Gne'
ID219328
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44055273 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000100000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000172533] [ENSMUST00000173234] [ENSMUST00000173274] [ENSMUST00000173383]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
AA Change: E265G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: E265G

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102936
AA Change: E234G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: E234G

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128439
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably benign
Transcript: ENSMUST00000140724
Predicted Effect probably benign
Transcript: ENSMUST00000144985
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172514
Predicted Effect probably benign
Transcript: ENSMUST00000172533
AA Change: E234G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: E234G

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173234
AA Change: E234G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: E234G

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173274
AA Change: E234G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134406
Gene: ENSMUSG00000028479
AA Change: E234G

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 292 2.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173383
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173976
Predicted Effect unknown
Transcript: ENSMUST00000174522
AA Change: E8G
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Dmp1 A G 5: 104,212,840 S461G probably damaging Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Limd1 A G 9: 123,479,499 S88G probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr248 G T 1: 174,391,429 R120L possibly damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Prss2 A T 6: 41,523,976 I108F probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim39 A G 17: 36,263,754 L252S possibly damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 intron probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGCATTTCCCAAGAGCC -3'
(R):5'- TATGAGAGAAGCTGGCTCCC -3'

Sequencing Primer
(F):5'- CCCAAGAGCCTTTAATAATAAGATCC -3'
(R):5'- CACCTTTGAAAATGGGTTCCAGGC -3'
Posted On2014-08-25