Incidental Mutation 'R0136:Ybx1'
ID21935
Institutional Source Beutler Lab
Gene Symbol Ybx1
Ensembl Gene ENSMUSG00000028639
Gene NameY box protein 1
SynonymsdbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0136 (G1)
Quality Score205
Status Validated (trace)
Chromosome4
Chromosomal Location119277981-119294604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119282354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 36 (R36L)
Ref Sequence ENSEMBL: ENSMUSP00000117225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]
Predicted Effect probably benign
Transcript: ENSMUST00000079644
AA Change: R148L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639
AA Change: R148L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 25 48 N/A INTRINSIC
CSP 58 126 8.65e-24 SMART
low complexity region 140 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 206 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127737
AA Change: R36L

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639
AA Change: R36L

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145976
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Ybx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ybx1 APN 4 119282312 missense probably damaging 1.00
IGL02635:Ybx1 APN 4 119279089 missense possibly damaging 0.88
R0270:Ybx1 UTSW 4 119281591 missense probably benign 0.11
R4911:Ybx1 UTSW 4 119282813 missense probably benign 0.13
R4957:Ybx1 UTSW 4 119278938 utr 3 prime probably benign
R4986:Ybx1 UTSW 4 119282430 missense probably damaging 0.99
R5205:Ybx1 UTSW 4 119279151 missense probably damaging 1.00
R7098:Ybx1 UTSW 4 119282853 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGTTCAATTCCCAGGACAAGCAC -3'
(R):5'- TGATGTAGCATTCCCATGCACCC -3'

Sequencing Primer
(F):5'- AAACCCTTGTTACACTCAATGTC -3'
(R):5'- CTTTGCCCATGCACACAG -3'
Posted On2013-04-12