Mutagenetix > Incidental Mutation

Incidental Mutation 'R2009:Pik3c2a'

219361

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

040018-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2009 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115936500-116042684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 115963738 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 924 (L924R)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: L924R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: L924R

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: L924R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

unknown
Transcript: ENSMUST00000206385
AA Change: L87R

Meta Mutation Damage Score

0.7771

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	T	A	9: 30,833,433 (GRCm39)	D34V	probably benign	Het
Adgrf1	A	T	17: 43,632,112 (GRCm39)	R884*	probably null	Het
Adgrg7	T	C	16: 56,582,236 (GRCm39)	T301A	probably benign	Het
Arhgef17	A	G	7: 100,530,988 (GRCm39)	I1366T	probably damaging	Het
C1s2	A	T	6: 124,612,048 (GRCm39)	L112H	probably damaging	Het
C2cd6	A	T	1: 59,042,391 (GRCm39)		noncoding transcript	Het
Cfap74	G	A	4: 155,504,724 (GRCm39)	R103H	possibly damaging	Het
Col7a1	A	T	9: 108,797,943 (GRCm39)		probably null	Het
Dmp1	A	G	5: 104,360,706 (GRCm39)	S461G	probably damaging	Het
Eif4g2	A	T	7: 110,673,405 (GRCm39)	D753E	probably benign	Het
Espl1	A	G	15: 102,221,424 (GRCm39)	I944V	probably damaging	Het
Etv4	T	C	11: 101,665,063 (GRCm39)	D130G	probably damaging	Het
Gabbr2	A	T	4: 46,734,119 (GRCm39)	I533N	probably damaging	Het
Gne	T	C	4: 44,055,273 (GRCm39)	E234G	probably benign	Het
Itga6	C	A	2: 71,647,025 (GRCm39)	N78K	probably benign	Het
Lap3	C	T	5: 45,650,899 (GRCm39)	T33M	probably benign	Het
Limd1	A	G	9: 123,308,564 (GRCm39)	S88G	probably benign	Het
Lrp1	G	T	10: 127,380,385 (GRCm39)	T3922K	probably damaging	Het
Map4k3	A	G	17: 80,971,517 (GRCm39)		probably benign	Het
Mib1	T	C	18: 10,812,118 (GRCm39)	L263S	probably damaging	Het
Ncor1	T	C	11: 62,216,427 (GRCm39)	S1474G	probably benign	Het
Nkapl	A	C	13: 21,651,607 (GRCm39)	S335R	probably damaging	Het
Nrg3	A	G	14: 38,092,771 (GRCm39)	S605P	probably damaging	Het
Or10x4	G	T	1: 174,218,995 (GRCm39)	R120L	possibly damaging	Het
Or52b3	A	G	7: 102,204,151 (GRCm39)	Y220C	probably damaging	Het
Patj	G	A	4: 98,344,406 (GRCm39)	D577N	probably damaging	Het
Pfpl	A	C	19: 12,407,319 (GRCm39)	K523N	possibly damaging	Het
Pkd2l1	C	A	19: 44,144,403 (GRCm39)	R278L	probably benign	Het
Prss2	A	T	6: 41,500,910 (GRCm39)	I108F	probably damaging	Het
Rnase2b	A	G	14: 51,400,347 (GRCm39)	T143A	possibly damaging	Het
Sgk1	C	T	10: 21,872,500 (GRCm39)	R171W	probably damaging	Het
Sphk2	A	T	7: 45,360,437 (GRCm39)	H522Q	probably damaging	Het
Szt2	A	G	4: 118,235,261 (GRCm39)		probably null	Het
Tmem88	C	A	11: 69,288,602 (GRCm39)	A106S	probably damaging	Het
Trappc14	C	A	5: 138,259,191 (GRCm39)	C434F	probably damaging	Het
Trim39	A	G	17: 36,574,646 (GRCm39)	L252S	possibly damaging	Het
Trim60	T	A	8: 65,453,975 (GRCm39)	E91D	probably damaging	Het
Trpm5	A	G	7: 142,641,475 (GRCm39)	I145T	possibly damaging	Het
Vmn2r107	A	T	17: 20,595,729 (GRCm39)	M761L	probably benign	Het
Wdr4	G	A	17: 31,719,584 (GRCm39)		probably benign	Het
Wfs1	A	T	5: 37,125,653 (GRCm39)	S413T	probably damaging	Het
Wnt2	A	T	6: 18,030,208 (GRCm39)	W27R	probably damaging	Het
Zc3h3	A	T	15: 75,651,158 (GRCm39)	H687Q	probably damaging	Het
Zfp750	G	A	11: 121,403,951 (GRCm39)	P308L	possibly damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	115,963,735 (GRCm39)	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	115,973,038 (GRCm39)	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116,017,429 (GRCm39)	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	115,975,485 (GRCm39)	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	115,950,000 (GRCm39)	intron	probably benign
IGL01695:Pik3c2a	APN	7	116,016,753 (GRCm39)	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	115,945,423 (GRCm39)	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	115,950,039 (GRCm39)	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	115,987,299 (GRCm39)	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	115,962,575 (GRCm39)	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116,005,126 (GRCm39)	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	115,972,049 (GRCm39)	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	115,963,748 (GRCm39)	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116,017,256 (GRCm39)	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116,017,074 (GRCm39)	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	115,953,307 (GRCm39)	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	115,972,979 (GRCm39)	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	115,953,290 (GRCm39)	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	115,945,482 (GRCm39)	splice site	probably benign
R0991:Pik3c2a	UTSW	7	115,961,280 (GRCm39)	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	115,950,160 (GRCm39)	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116,016,908 (GRCm39)	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	115,987,300 (GRCm39)	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	115,987,280 (GRCm39)	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	115,968,083 (GRCm39)	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116,017,162 (GRCm39)	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116,017,755 (GRCm39)	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	115,945,471 (GRCm39)	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116,016,899 (GRCm39)	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	115,975,747 (GRCm39)	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	115,967,352 (GRCm39)	missense	probably benign
R1875:Pik3c2a	UTSW	7	116,017,206 (GRCm39)	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	115,953,241 (GRCm39)	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	115,941,472 (GRCm39)	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	115,950,057 (GRCm39)	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116,016,686 (GRCm39)	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	115,972,126 (GRCm39)	nonsense	probably null
R3814:Pik3c2a	UTSW	7	115,947,414 (GRCm39)	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	115,963,785 (GRCm39)	nonsense	probably null
R4386:Pik3c2a	UTSW	7	115,953,334 (GRCm39)	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	115,957,923 (GRCm39)	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116,017,060 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	115,947,509 (GRCm39)	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	115,941,636 (GRCm39)	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	115,950,021 (GRCm39)	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116,016,893 (GRCm39)	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116,005,186 (GRCm39)	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	115,967,419 (GRCm39)	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	115,961,799 (GRCm39)	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	115,947,440 (GRCm39)	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116,016,731 (GRCm39)	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	115,939,460 (GRCm39)	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	115,967,993 (GRCm39)	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	115,961,419 (GRCm39)	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	115,993,540 (GRCm39)	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116,017,223 (GRCm39)	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116,017,368 (GRCm39)	nonsense	probably null
R7153:Pik3c2a	UTSW	7	115,941,487 (GRCm39)	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	115,987,331 (GRCm39)	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	115,987,321 (GRCm39)	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116,005,178 (GRCm39)	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	115,973,074 (GRCm39)	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	115,975,621 (GRCm39)	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	115,953,242 (GRCm39)	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	115,972,089 (GRCm39)	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	115,993,474 (GRCm39)	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	115,939,331 (GRCm39)	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	115,987,312 (GRCm39)	nonsense	probably null
R7737:Pik3c2a	UTSW	7	115,955,488 (GRCm39)	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	115,993,529 (GRCm39)	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116,016,693 (GRCm39)	missense	probably benign
R7922:Pik3c2a	UTSW	7	115,990,517 (GRCm39)	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	115,949,350 (GRCm39)	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116,017,271 (GRCm39)	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	115,942,232 (GRCm39)	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116,017,283 (GRCm39)	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116,017,584 (GRCm39)	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	115,975,464 (GRCm39)	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	115,951,112 (GRCm39)	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116,017,659 (GRCm39)	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	115,987,320 (GRCm39)	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	115,993,531 (GRCm39)	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116,017,004 (GRCm39)	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116,017,115 (GRCm39)	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	115,945,413 (GRCm39)	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	115,990,558 (GRCm39)	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	115,961,289 (GRCm39)	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	115,939,321 (GRCm39)	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	115,957,939 (GRCm39)	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	115,945,427 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGTTTTCACGTTAAAAGGG -3'
(R):5'- GGCAGAACGATTTTCATCTCC -3'

Sequencing Primer
(F):5'- GTTTTCACGTTAAAAGGGAAGTACC -3'
(R):5'- GATGTTTGCTATGCATTGAATATTCC -3'

Posted On

2014-08-25