Incidental Mutation 'R2009:Limd1'
ID219373
Institutional Source Beutler Lab
Gene Symbol Limd1
Ensembl Gene ENSMUSG00000025239
Gene NameLIM domains containing 1
SynonymsD9Ertd192e
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123478706-123521552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123479499 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 88 (S88G)
Ref Sequence ENSEMBL: ENSMUSP00000026269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026269]
Predicted Effect probably benign
Transcript: ENSMUST00000026269
AA Change: S88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026269
Gene: ENSMUSG00000025239
AA Change: S88G

DomainStartEndE-ValueType
low complexity region 57 67 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
LIM 463 516 2.17e-15 SMART
LIM 528 580 9.6e-17 SMART
LIM 588 649 2.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216352
Predicted Effect probably benign
Transcript: ENSMUST00000217639
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal bone osteoclast numbers and bone density but are resistant to physiological and pathologic osteoclastogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Dmp1 A G 5: 104,212,840 S461G probably damaging Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Gne T C 4: 44,055,273 E234G probably benign Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr248 G T 1: 174,391,429 R120L possibly damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Prss2 A T 6: 41,523,976 I108F probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim39 A G 17: 36,263,754 L252S possibly damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Limd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Limd1 APN 9 123479883 missense probably benign 0.31
IGL00972:Limd1 APN 9 123480076 missense probably benign 0.06
IGL01815:Limd1 APN 9 123479736 missense probably benign 0.01
IGL02598:Limd1 APN 9 123516868 missense probably benign 0.11
IGL02598:Limd1 APN 9 123480171 missense probably benign
IGL02633:Limd1 APN 9 123479922 unclassified probably benign
IGL02999:Limd1 APN 9 123516799 missense probably damaging 1.00
R0314:Limd1 UTSW 9 123516827 missense probably benign 0.04
R1612:Limd1 UTSW 9 123518154 missense probably damaging 1.00
R2299:Limd1 UTSW 9 123516877 nonsense probably null
R3791:Limd1 UTSW 9 123480374 missense possibly damaging 0.92
R4453:Limd1 UTSW 9 123480294 missense possibly damaging 0.52
R5979:Limd1 UTSW 9 123479414 missense possibly damaging 0.96
X0028:Limd1 UTSW 9 123516862 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGTATGAGGCCTCCAAGG -3'
(R):5'- AAGCAGGTCTCTGGGAACTC -3'

Sequencing Primer
(F):5'- AAGGATGGGCTCTTCCGG -3'
(R):5'- TGGGAACTCACAGGCCC -3'
Posted On2014-08-25