Incidental Mutation 'R2010:Fancd2'
ID219466
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission 040019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2010 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113593291 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1401 (D1401V)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035870] [ENSMUST00000036340] [ENSMUST00000125139] [ENSMUST00000204827]
Predicted Effect probably benign
Transcript: ENSMUST00000035870
SMART Domains Protein: ENSMUSP00000035316
Gene: ENSMUSG00000033963

DomainStartEndE-ValueType
Pfam:DUF4563 3 178 1.4e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: D1414V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: D1414V

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125139
SMART Domains Protein: ENSMUSP00000121804
Gene: ENSMUSG00000033963

DomainStartEndE-ValueType
Pfam:DUF4563 1 178 5.2e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: D1401V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: D1401V

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,481,806 G74S unknown Het
4930452B06Rik A T 14: 8,511,021 F464L probably damaging Het
4932438A13Rik T G 3: 36,928,551 N788K probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Arhgef6 T C X: 57,299,505 T52A possibly damaging Het
Aste1 C A 9: 105,403,502 H25Q probably damaging Het
Atp13a1 G A 8: 69,791,360 G36R possibly damaging Het
Bahcc1 T C 11: 120,272,778 V634A probably damaging Het
C1s1 A T 6: 124,537,394 Y168N probably damaging Het
Camsap2 T C 1: 136,274,868 S612G probably damaging Het
Cdh23 C A 10: 60,314,227 R2611L probably damaging Het
Cilp2 A G 8: 69,881,694 Y885H probably damaging Het
D430042O09Rik A G 7: 125,872,956 I1544M possibly damaging Het
Dhrs3 C T 4: 144,927,188 T227I possibly damaging Het
Dnah2 A T 11: 69,458,358 probably null Het
Dnah3 T G 7: 120,095,177 M1L probably benign Het
Ehbp1l1 A G 19: 5,719,283 I664T probably benign Het
Eif4e C T 3: 138,555,458 T171I probably benign Het
Elfn1 C T 5: 139,973,316 R692W probably damaging Het
Eps8l3 T A 3: 107,879,372 M1K probably null Het
Evi5 C A 5: 107,813,545 probably null Het
Fat2 G A 11: 55,253,827 R4074C probably damaging Het
Fkbp4 A T 6: 128,435,802 V55E probably benign Het
Fnip1 A G 11: 54,482,503 D180G probably damaging Het
Galc A G 12: 98,254,230 F126S possibly damaging Het
Gdf7 C T 12: 8,301,729 V69M unknown Het
Glis2 A G 16: 4,608,711 E22G probably damaging Het
Hist1h2bb G A 13: 23,747,128 V112M possibly damaging Het
Hps4 T A 5: 112,369,476 V243E probably damaging Het
Ighe T A 12: 113,271,488 I351F unknown Het
Irak4 A T 15: 94,551,806 R55S probably damaging Het
Itpr2 G A 6: 146,227,524 probably null Het
Kirrel3 T C 9: 34,939,198 Y41H probably damaging Het
Krr1 A G 10: 111,975,569 E56G possibly damaging Het
Lgi1 G A 19: 38,301,235 V250I probably damaging Het
Lipf A G 19: 33,973,546 N306D probably benign Het
Lman2l C T 1: 36,445,181 W18* probably null Het
Lztfl1 T A 9: 123,702,186 N239I possibly damaging Het
Mief1 T C 15: 80,247,925 S66P possibly damaging Het
Mmp8 C A 9: 7,567,534 S465* probably null Het
Muc2 A T 7: 141,700,875 T208S probably damaging Het
Myh8 A T 11: 67,297,164 K921* probably null Het
Myh9 T C 15: 77,771,947 E1121G probably benign Het
Nbn T C 4: 15,969,393 S213P probably damaging Het
Nol10 A G 12: 17,416,101 E499G probably benign Het
Nxn T C 11: 76,398,801 E87G probably damaging Het
Olfr293 A G 7: 86,664,603 T314A probably benign Het
Olfr568 T A 7: 102,877,685 C188* probably null Het
Olfr937 T C 9: 39,060,099 H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Pigk A G 3: 152,766,514 I354M probably damaging Het
Pigl T A 11: 62,458,682 C75S probably damaging Het
Pm20d1 T A 1: 131,812,114 I400N probably benign Het
Prkg2 T A 5: 99,024,805 H17L probably benign Het
Psmd1 T A 1: 86,075,997 L168Q probably damaging Het
Rab3gap2 A T 1: 185,278,281 H1136L possibly damaging Het
Rb1 T C 14: 73,294,993 T134A probably benign Het
Rims1 T C 1: 22,296,996 E1024G probably damaging Het
Rrp12 A G 19: 41,872,937 V977A probably benign Het
Rusc2 C T 4: 43,415,212 P173S probably benign Het
Selenov A T 7: 28,288,022 D310E probably damaging Het
Serpina3f T A 12: 104,217,323 L148Q probably damaging Het
Slc10a1 C T 12: 80,960,447 V187I probably benign Het
Spsb2 A G 6: 124,810,376 K258E probably damaging Het
Tas2r105 A C 6: 131,687,402 V21G probably benign Het
Tmem229b-ps T A 10: 53,475,199 noncoding transcript Het
Tnrc6a C G 7: 123,171,046 H686Q probably benign Het
Trpc2 T A 7: 102,094,573 F715L probably benign Het
Ube2t T A 1: 134,969,298 I56N probably benign Het
Ubr4 T C 4: 139,480,652 Y4915H possibly damaging Het
Usp32 T A 11: 85,040,004 E533D probably damaging Het
Vipr2 T G 12: 116,122,810 probably null Het
Vmn1r15 A G 6: 57,258,284 T46A probably benign Het
Vmn1r203 T G 13: 22,524,447 S133A possibly damaging Het
Vmn1r215 T G 13: 23,076,208 N139K probably damaging Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Wdr20rt C A 12: 65,227,214 H311N possibly damaging Het
Zranb1 T C 7: 132,966,696 probably null Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 unclassified probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 intron probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCTTCCCTGAATGATAGGTCAG -3'
(R):5'- TGGATCCCAAAGCATTCATGTAAG -3'

Sequencing Primer
(F):5'- CCCTGAATGATAGGTCAGAGGTTG -3'
(R):5'- GAGATGGGCACAGAGTTATT -3'
Posted On2014-08-25