Incidental Mutation 'R1969:Lyst'
ID219517
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
MMRRC Submission 039982-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R1969 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13730344 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 3202 (R3202H)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably damaging
Transcript: ENSMUST00000110559
AA Change: R3202H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: R3202H

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Col24a1 T C 3: 145,314,930 I354T probably benign Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Gucy2g T C 19: 55,222,896 Y634C possibly damaging Het
Gucy2g T G 19: 55,233,053 T339P probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hey1 T C 3: 8,666,819 T18A probably benign Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTATGACAGGGTAGCAGTGG -3'
(R):5'- TACAGCATGACTTTGGGGTAG -3'

Sequencing Primer
(F):5'- CTCATTTGGCCTAGGGTCAG -3'
(R):5'- CTTTGGGGTAGTTACAAAAGACATCC -3'
Posted On2014-08-25