Incidental Mutation 'R2010:Myh8'
ID219524
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 040019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R2010 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 67297164 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 921 (K921*)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably null
Transcript: ENSMUST00000019625
AA Change: K921*
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: K921*

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,481,806 G74S unknown Het
4930452B06Rik A T 14: 8,511,021 F464L probably damaging Het
4932438A13Rik T G 3: 36,928,551 N788K probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Arhgef6 T C X: 57,299,505 T52A possibly damaging Het
Aste1 C A 9: 105,403,502 H25Q probably damaging Het
Atp13a1 G A 8: 69,791,360 G36R possibly damaging Het
Bahcc1 T C 11: 120,272,778 V634A probably damaging Het
C1s1 A T 6: 124,537,394 Y168N probably damaging Het
Camsap2 T C 1: 136,274,868 S612G probably damaging Het
Cdh23 C A 10: 60,314,227 R2611L probably damaging Het
Cilp2 A G 8: 69,881,694 Y885H probably damaging Het
D430042O09Rik A G 7: 125,872,956 I1544M possibly damaging Het
Dhrs3 C T 4: 144,927,188 T227I possibly damaging Het
Dnah2 A T 11: 69,458,358 probably null Het
Dnah3 T G 7: 120,095,177 M1L probably benign Het
Ehbp1l1 A G 19: 5,719,283 I664T probably benign Het
Eif4e C T 3: 138,555,458 T171I probably benign Het
Elfn1 C T 5: 139,973,316 R692W probably damaging Het
Eps8l3 T A 3: 107,879,372 M1K probably null Het
Evi5 C A 5: 107,813,545 probably null Het
Fancd2 A T 6: 113,593,291 D1401V probably damaging Het
Fat2 G A 11: 55,253,827 R4074C probably damaging Het
Fkbp4 A T 6: 128,435,802 V55E probably benign Het
Fnip1 A G 11: 54,482,503 D180G probably damaging Het
Galc A G 12: 98,254,230 F126S possibly damaging Het
Gdf7 C T 12: 8,301,729 V69M unknown Het
Glis2 A G 16: 4,608,711 E22G probably damaging Het
Hist1h2bb G A 13: 23,747,128 V112M possibly damaging Het
Hps4 T A 5: 112,369,476 V243E probably damaging Het
Ighe T A 12: 113,271,488 I351F unknown Het
Irak4 A T 15: 94,551,806 R55S probably damaging Het
Itpr2 G A 6: 146,227,524 probably null Het
Kirrel3 T C 9: 34,939,198 Y41H probably damaging Het
Krr1 A G 10: 111,975,569 E56G possibly damaging Het
Lgi1 G A 19: 38,301,235 V250I probably damaging Het
Lipf A G 19: 33,973,546 N306D probably benign Het
Lman2l C T 1: 36,445,181 W18* probably null Het
Lztfl1 T A 9: 123,702,186 N239I possibly damaging Het
Mief1 T C 15: 80,247,925 S66P possibly damaging Het
Mmp8 C A 9: 7,567,534 S465* probably null Het
Muc2 A T 7: 141,700,875 T208S probably damaging Het
Myh9 T C 15: 77,771,947 E1121G probably benign Het
Nbn T C 4: 15,969,393 S213P probably damaging Het
Nol10 A G 12: 17,416,101 E499G probably benign Het
Nxn T C 11: 76,398,801 E87G probably damaging Het
Olfr293 A G 7: 86,664,603 T314A probably benign Het
Olfr568 T A 7: 102,877,685 C188* probably null Het
Olfr937 T C 9: 39,060,099 H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Pigk A G 3: 152,766,514 I354M probably damaging Het
Pigl T A 11: 62,458,682 C75S probably damaging Het
Pm20d1 T A 1: 131,812,114 I400N probably benign Het
Prkg2 T A 5: 99,024,805 H17L probably benign Het
Psmd1 T A 1: 86,075,997 L168Q probably damaging Het
Rab3gap2 A T 1: 185,278,281 H1136L possibly damaging Het
Rb1 T C 14: 73,294,993 T134A probably benign Het
Rims1 T C 1: 22,296,996 E1024G probably damaging Het
Rrp12 A G 19: 41,872,937 V977A probably benign Het
Rusc2 C T 4: 43,415,212 P173S probably benign Het
Selenov A T 7: 28,288,022 D310E probably damaging Het
Serpina3f T A 12: 104,217,323 L148Q probably damaging Het
Slc10a1 C T 12: 80,960,447 V187I probably benign Het
Spsb2 A G 6: 124,810,376 K258E probably damaging Het
Tas2r105 A C 6: 131,687,402 V21G probably benign Het
Tmem229b-ps T A 10: 53,475,199 noncoding transcript Het
Tnrc6a C G 7: 123,171,046 H686Q probably benign Het
Trpc2 T A 7: 102,094,573 F715L probably benign Het
Ube2t T A 1: 134,969,298 I56N probably benign Het
Ubr4 T C 4: 139,480,652 Y4915H possibly damaging Het
Usp32 T A 11: 85,040,004 E533D probably damaging Het
Vipr2 T G 12: 116,122,810 probably null Het
Vmn1r15 A G 6: 57,258,284 T46A probably benign Het
Vmn1r203 T G 13: 22,524,447 S133A possibly damaging Het
Vmn1r215 T G 13: 23,076,208 N139K probably damaging Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Wdr20rt C A 12: 65,227,214 H311N possibly damaging Het
Zranb1 T C 7: 132,966,696 probably null Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCTAATACTCAATTCAAGGTG -3'
(R):5'- TCCCGTGTAGACGTCTCATAC -3'

Sequencing Primer
(F):5'- TCAAGGTGAACTTATGTTTATGCTG -3'
(R):5'- GTGTAGACGTCTCATACCTTGTTC -3'
Posted On2014-08-25