Incidental Mutation 'R0136:Nsd3'
ID21956
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 038421-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 25659854 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 352 (E352*)
Ref Sequence ENSEMBL: ENSMUSP00000117596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
Predicted Effect probably null
Transcript: ENSMUST00000084026
AA Change: E352*
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: E352*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136107
AA Change: E352*
Predicted Effect probably null
Transcript: ENSMUST00000139966
AA Change: E352*
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: E352*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142395
AA Change: E352*
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: E352*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143445
AA Change: E352*
Predicted Effect probably null
Transcript: ENSMUST00000146919
AA Change: E352*
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: E352*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155861
AA Change: E352*
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: E352*

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTGAATCACTGTAGGGGTCACAGGA -3'
(R):5'- TGCGTGACATACACAACTGTGCATT -3'

Sequencing Primer
(F):5'- GATCAGTGTTTGCCTCTTAAAAGTTC -3'
(R):5'- tctgcatggcctggaac -3'
Posted On2013-04-12