Incidental Mutation 'R1970:Ncor2'
ID219682
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Namenuclear receptor co-repressor 2
SynonymsSMRT, SMRTe
MMRRC Submission 039983-MU
Accession Numbers

Ncbi RefSeq: NM_011424.3, NM_001253904.1, NM_001253905.1; MGI:1337080

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1970 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location125017153-125179219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125038918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 858 (D858G)
Ref Sequence ENSEMBL: ENSMUSP00000107025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402] [ENSMUST00000134404]
Predicted Effect probably damaging
Transcript: ENSMUST00000055256
AA Change: D1078G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478
AA Change: D1078G

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086083
AA Change: D1077G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478
AA Change: D1077G

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111393
AA Change: D902G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478
AA Change: D902G

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111394
AA Change: D858G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478
AA Change: D858G

DomainStartEndE-ValueType
SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111398
AA Change: D1077G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478
AA Change: D1077G

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111402
AA Change: D1077G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478
AA Change: D1077G

DomainStartEndE-ValueType
Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125053
AA Change: D124G
SMART Domains Protein: ENSMUSP00000117098
Gene: ENSMUSG00000029478
AA Change: D124G

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 133 143 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 563 579 N/A INTRINSIC
low complexity region 698 704 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
low complexity region 819 836 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1038 1054 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
PDB:2GPV|I 1372 1393 5e-8 PDB
low complexity region 1403 1415 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134404
AA Change: D491G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121588
Gene: ENSMUSG00000029478
AA Change: D491G

DomainStartEndE-ValueType
SANT 2 49 1.94e-2 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 113 140 N/A INTRINSIC
low complexity region 182 227 N/A INTRINSIC
low complexity region 236 242 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 281 288 N/A INTRINSIC
low complexity region 319 333 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 424 438 N/A INTRINSIC
low complexity region 440 456 N/A INTRINSIC
low complexity region 499 509 N/A INTRINSIC
low complexity region 513 529 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype Strain: 3765904; 4329504
Lethality: E1-E16
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125042743 critical splice donor site probably null
IGL00519:Ncor2 APN 5 125084924 missense unknown
IGL00900:Ncor2 APN 5 125025784 missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125086890 missense unknown
IGL01320:Ncor2 APN 5 125109927 missense probably benign 0.00
IGL01382:Ncor2 APN 5 125055773 missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125085026 missense unknown
IGL01721:Ncor2 APN 5 125050937 missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125065870 missense unknown
IGL02090:Ncor2 APN 5 125034403 missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125024237 missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125037914 missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125025557 missense probably benign 0.33
IGL02997:Ncor2 APN 5 125119570 intron probably benign
R0019:Ncor2 UTSW 5 125119481 critical splice donor site probably null
R0331:Ncor2 UTSW 5 125084917 missense unknown
R0333:Ncor2 UTSW 5 125034344 splice site probably benign
R0403:Ncor2 UTSW 5 125033337 missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125106305 nonsense probably null
R0562:Ncor2 UTSW 5 125085029 missense unknown
R0671:Ncor2 UTSW 5 125049387 missense probably benign 0.13
R0699:Ncor2 UTSW 5 125029112 unclassified probably benign
R0865:Ncor2 UTSW 5 125038982 missense probably benign 0.17
R1183:Ncor2 UTSW 5 125023521 missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125118780 intron probably benign
R1344:Ncor2 UTSW 5 125025446 missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125109975 intron probably benign
R1481:Ncor2 UTSW 5 125027138 nonsense probably null
R1539:Ncor2 UTSW 5 125109939 missense probably benign 0.07
R1558:Ncor2 UTSW 5 125033546 missense probably damaging 1.00
R1585:Ncor2 UTSW 5 125084998 missense unknown
R1611:Ncor2 UTSW 5 125110020 intron probably benign
R1764:Ncor2 UTSW 5 125028615 missense possibly damaging 0.91
R1789:Ncor2 UTSW 5 125019890 missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125118793 intron probably benign
R1901:Ncor2 UTSW 5 125025425 missense probably benign 0.39
R1946:Ncor2 UTSW 5 125034412 missense probably damaging 1.00
R2048:Ncor2 UTSW 5 125084932 missense unknown
R2137:Ncor2 UTSW 5 125030712 missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125037955 missense probably benign 0.33
R2380:Ncor2 UTSW 5 125036080 missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125028800 critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125025760 missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125024166 missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125028687 missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125118692 intron probably benign
R3829:Ncor2 UTSW 5 125118692 intron probably benign
R3830:Ncor2 UTSW 5 125118692 intron probably benign
R3951:Ncor2 UTSW 5 125032256 missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125050956 missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125028972 missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125102641 critical splice donor site probably null
R4490:Ncor2 UTSW 5 125036815 splice site probably null
R4573:Ncor2 UTSW 5 125055825 missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125030859 missense probably damaging 1.00
R4799:Ncor2 UTSW 5 125037060 critical splice donor site probably null
R4851:Ncor2 UTSW 5 125033367 missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125025105 missense probably damaging 0.99
R4853:Ncor2 UTSW 5 125081183 missense unknown
R4896:Ncor2 UTSW 5 125049340 critical splice donor site probably null
R4997:Ncor2 UTSW 5 125034010 missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125048066 missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125026930 missense probably benign 0.44
R5461:Ncor2 UTSW 5 125027113 missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125067911 nonsense probably null
R5638:Ncor2 UTSW 5 125048300 missense probably benign 0.33
R5879:Ncor2 UTSW 5 125026775 unclassified probably benign
R5967:Ncor2 UTSW 5 125068984 missense unknown
R5999:Ncor2 UTSW 5 125033441 missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125020011 missense probably benign 0.14
R6109:Ncor2 UTSW 5 125055846 missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125087902 missense unknown
R6462:Ncor2 UTSW 5 125024172 missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125110005 intron probably benign
Z1088:Ncor2 UTSW 5 125067788 missense unknown
Z1088:Ncor2 UTSW 5 125086840 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTCCCGAGTCTCAGAAGGTG -3'
(R):5'- TTGTCAGGGTCCTGTCACAG -3'

Sequencing Primer
(F):5'- AAGGTGCCCAGCTTCACAG -3'
(R):5'- TGTCACAGCTTGCCAGTG -3'
Posted On2014-08-25