Incidental Mutation 'R1970:Numa1'
ID219706
Institutional Source Beutler Lab
Gene Symbol Numa1
Ensembl Gene ENSMUSG00000066306
Gene Namenuclear mitotic apparatus protein 1
Synonyms6720401E04Rik
MMRRC Submission 039983-MU
Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1970 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101934111-102014964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102009322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1605 (A1605V)
Ref Sequence ENSEMBL: ENSMUSP00000081912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000163183]
Predicted Effect probably damaging
Transcript: ENSMUST00000084852
AA Change: A1605V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: A1605V

DomainStartEndE-ValueType
low complexity region 187 201 N/A INTRINSIC
coiled coil region 211 249 N/A INTRINSIC
coiled coil region 274 818 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
internal_repeat_1 910 933 6.03e-6 PROSPERO
internal_repeat_2 911 951 2.35e-5 PROSPERO
low complexity region 979 992 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1063 1081 N/A INTRINSIC
internal_repeat_5 1094 1116 4.63e-5 PROSPERO
low complexity region 1130 1138 N/A INTRINSIC
low complexity region 1220 1233 N/A INTRINSIC
low complexity region 1271 1289 N/A INTRINSIC
low complexity region 1364 1374 N/A INTRINSIC
coiled coil region 1464 1681 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
internal_repeat_3 1718 1755 4.63e-5 PROSPERO
internal_repeat_4 1777 1819 4.63e-5 PROSPERO
internal_repeat_3 1800 1842 4.63e-5 PROSPERO
internal_repeat_4 1811 1854 4.63e-5 PROSPERO
low complexity region 1859 1875 N/A INTRINSIC
PDB:3RO2|B 1881 1908 3e-13 PDB
internal_repeat_2 1938 1977 2.35e-5 PROSPERO
internal_repeat_5 1973 1995 4.63e-5 PROSPERO
internal_repeat_1 2020 2043 6.03e-6 PROSPERO
low complexity region 2073 2085 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163183
AA Change: A252V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306
AA Change: A252V

DomainStartEndE-ValueType
coiled coil region 7 73 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
SCOP:d1fxkc_ 164 290 7e-3 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 506 522 N/A INTRINSIC
PDB:3RO2|B 528 555 2e-10 PDB
low complexity region 720 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210353
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]
Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Numa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Numa1 APN 7 102013286 missense possibly damaging 0.95
IGL00819:Numa1 APN 7 101992710 missense possibly damaging 0.90
IGL01103:Numa1 APN 7 102001571 missense probably benign 0.01
IGL01153:Numa1 APN 7 101994744 missense probably damaging 1.00
IGL01954:Numa1 APN 7 101996093 nonsense probably null
IGL02114:Numa1 APN 7 102011876 unclassified probably benign
IGL02245:Numa1 APN 7 102000394 missense probably benign 0.02
IGL02259:Numa1 APN 7 101987748 missense possibly damaging 0.93
IGL02313:Numa1 APN 7 102000232 nonsense probably null
IGL02316:Numa1 APN 7 102001370 missense probably damaging 1.00
IGL02386:Numa1 APN 7 102007532 missense probably benign 0.00
IGL02517:Numa1 APN 7 102012009 missense probably benign 0.01
IGL02529:Numa1 APN 7 101999953 unclassified probably null
IGL02664:Numa1 APN 7 101998902 missense possibly damaging 0.83
IGL02721:Numa1 APN 7 101999911 missense probably benign 0.01
IGL02816:Numa1 APN 7 101996100 missense probably damaging 1.00
IGL03126:Numa1 APN 7 102000667 nonsense probably null
Meltdown UTSW 7 101990571 critical splice acceptor site probably null
1mM(1):Numa1 UTSW 7 101994715 missense probably benign 0.06
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0047:Numa1 UTSW 7 102009453 missense probably damaging 1.00
R0548:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0554:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R0592:Numa1 UTSW 7 102013897 missense probably benign
R0669:Numa1 UTSW 7 101999677 missense probably benign
R0856:Numa1 UTSW 7 101998948 missense probably damaging 1.00
R1072:Numa1 UTSW 7 102001150 unclassified probably null
R1776:Numa1 UTSW 7 102011050 missense probably damaging 1.00
R1898:Numa1 UTSW 7 101992720 critical splice donor site probably null
R1969:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R1971:Numa1 UTSW 7 102009322 missense probably damaging 0.98
R2180:Numa1 UTSW 7 101999990 missense probably benign 0.00
R2256:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2257:Numa1 UTSW 7 102000791 missense probably damaging 0.99
R2508:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R2958:Numa1 UTSW 7 102009495 missense possibly damaging 0.92
R4210:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4211:Numa1 UTSW 7 102009738 missense probably damaging 1.00
R4643:Numa1 UTSW 7 102000665 unclassified probably null
R4783:Numa1 UTSW 7 102013566 missense probably damaging 1.00
R4823:Numa1 UTSW 7 101996037 missense probably damaging 1.00
R4908:Numa1 UTSW 7 102012805 missense probably damaging 1.00
R4934:Numa1 UTSW 7 102010857 missense probably benign 0.32
R4981:Numa1 UTSW 7 101992674 missense probably damaging 1.00
R5120:Numa1 UTSW 7 101977437 missense probably damaging 0.99
R5122:Numa1 UTSW 7 102013769 missense probably damaging 1.00
R5210:Numa1 UTSW 7 101999981 missense probably benign 0.03
R5230:Numa1 UTSW 7 101995524 missense possibly damaging 0.86
R5547:Numa1 UTSW 7 102013930 missense probably damaging 1.00
R5861:Numa1 UTSW 7 102009287 splice site probably null
R6006:Numa1 UTSW 7 101992719 critical splice donor site probably null
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6031:Numa1 UTSW 7 102012012 missense possibly damaging 0.86
R6295:Numa1 UTSW 7 102000767 missense probably benign 0.03
R6322:Numa1 UTSW 7 102000920 missense probably damaging 1.00
R6413:Numa1 UTSW 7 101990571 critical splice acceptor site probably null
R6786:Numa1 UTSW 7 101992638 missense probably benign 0.05
Z1088:Numa1 UTSW 7 101998331 missense probably damaging 0.99
Z1088:Numa1 UTSW 7 101998402 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGAAAGCCAGCAAGAGGTCC -3'
(R):5'- AAGTCACGAAGCTGCTGGTC -3'

Sequencing Primer
(F):5'- AGCAAGAGGTCCAGCGC -3'
(R):5'- CGAAGCTGCTGGTCTGCATG -3'
Posted On2014-08-25