Incidental Mutation 'R1970:Myo1e'
ID219739
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 039983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1970 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70368773 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 757 (F757L)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
AA Change: F757L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: F757L

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGTACTTCACTCTGAGCATCC -3'
(R):5'- CTGAAGGACTTTCACAAATTCCAAC -3'

Sequencing Primer
(F):5'- GTACTTCACTCTGAGCATCCTCCTC -3'
(R):5'- CCAACAATGAGGCTTGATTACTG -3'
Posted On2014-08-25