Incidental Mutation 'R1970:Top3b'
ID219819
Institutional Source Beutler Lab
Gene Symbol Top3b
Ensembl Gene ENSMUSG00000022779
Gene Nametopoisomerase (DNA) III beta
SynonymsTopo III beta
MMRRC Submission 039983-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1970 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16870736-16892990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16883519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000156132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000119787] [ENSMUST00000124960] [ENSMUST00000130650] [ENSMUST00000131063] [ENSMUST00000139740] [ENSMUST00000144513] [ENSMUST00000156502] [ENSMUST00000231812] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000232200] [ENSMUST00000232231] [ENSMUST00000232547] [ENSMUST00000232581]
Predicted Effect probably damaging
Transcript: ENSMUST00000023465
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779
AA Change: I232V

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118424
Predicted Effect probably damaging
Transcript: ENSMUST00000119787
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112913
Gene: ENSMUSG00000022779
AA Change: I232V

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124960
SMART Domains Protein: ENSMUSP00000118897
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
TOPRIM 3 118 3.89e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129969
Predicted Effect probably benign
Transcript: ENSMUST00000130650
SMART Domains Protein: ENSMUSP00000117906
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
Pfam:Toprim 4 69 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138618
Predicted Effect probably damaging
Transcript: ENSMUST00000139740
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118398
Gene: ENSMUSG00000022779
AA Change: I232V

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144513
SMART Domains Protein: ENSMUSP00000121645
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
SCOP:d1gkub3 1 55 1e-10 SMART
Blast:TOPRIM 3 55 5e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150424
Predicted Effect probably damaging
Transcript: ENSMUST00000156502
AA Change: I232V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115491
Gene: ENSMUSG00000022779
AA Change: I232V

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 234 4.29e-27 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115214
Gene: ENSMUSG00000022779
AA Change: I26V

DomainStartEndE-ValueType
TOP1Ac 84 340 2.28e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231576
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231834
Predicted Effect probably damaging
Transcript: ENSMUST00000232017
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000232080
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000232117
AA Change: I26V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232153
Predicted Effect probably benign
Transcript: ENSMUST00000232200
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably benign
Transcript: ENSMUST00000232547
Predicted Effect probably damaging
Transcript: ENSMUST00000232581
AA Change: I232V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232656
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Top3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Top3b APN 16 16887622 missense probably damaging 0.97
IGL01512:Top3b APN 16 16891422 missense possibly damaging 0.74
IGL01552:Top3b APN 16 16887823 splice site probably benign
IGL01738:Top3b APN 16 16880604 missense probably benign 0.04
IGL02090:Top3b APN 16 16891470 missense possibly damaging 0.81
R0143:Top3b UTSW 16 16883525 missense probably damaging 0.97
R0883:Top3b UTSW 16 16879437 splice site probably benign
R1386:Top3b UTSW 16 16880629 missense probably benign 0.29
R1440:Top3b UTSW 16 16892777 nonsense probably null
R1958:Top3b UTSW 16 16884302 missense possibly damaging 0.52
R4211:Top3b UTSW 16 16882532 unclassified probably null
R4292:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4307:Top3b UTSW 16 16889617 splice site probably benign
R4832:Top3b UTSW 16 16890662 nonsense probably null
R5047:Top3b UTSW 16 16891418 missense probably benign 0.00
R5364:Top3b UTSW 16 16886970 missense probably benign 0.00
R5590:Top3b UTSW 16 16891577 intron probably benign
R5604:Top3b UTSW 16 16889535 nonsense probably null
R5719:Top3b UTSW 16 16885836 missense probably damaging 1.00
R5969:Top3b UTSW 16 16883565 critical splice donor site probably null
R6018:Top3b UTSW 16 16892892 missense probably damaging 1.00
R6144:Top3b UTSW 16 16879141 unclassified probably null
R6155:Top3b UTSW 16 16891509 missense probably damaging 1.00
R6341:Top3b UTSW 16 16879071 missense probably damaging 0.98
R6700:Top3b UTSW 16 16892669 missense possibly damaging 0.48
X0011:Top3b UTSW 16 16890189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACCTAGGTTTACATGGGTTTGTC -3'
(R):5'- AAGCTGGTGACTCTACCTCCTG -3'

Sequencing Primer
(F):5'- TGGCGATTTAGACAGCTC -3'
(R):5'- CCAGGACCTACAACTGTTGATATTC -3'
Posted On2014-08-25