Incidental Mutation 'R1970:Foxp4'
ID219831
Institutional Source Beutler Lab
Gene Symbol Foxp4
Ensembl Gene ENSMUSG00000023991
Gene Nameforkhead box P4
Synonyms
MMRRC Submission 039983-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R1970 (G1)
Quality Score137
Status Validated
Chromosome17
Chromosomal Location47867133-47924645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47875871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 378 (R378Q)
Ref Sequence ENSEMBL: ENSMUSP00000108890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097311] [ENSMUST00000113262] [ENSMUST00000113263] [ENSMUST00000113265]
Predicted Effect unknown
Transcript: ENSMUST00000097311
AA Change: R379Q
SMART Domains Protein: ENSMUSP00000094916
Gene: ENSMUSG00000023991
AA Change: R379Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 470 552 4.69e-38 SMART
low complexity region 644 658 N/A INTRINSIC
low complexity region 671 683 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113262
AA Change: R379Q
SMART Domains Protein: ENSMUSP00000108887
Gene: ENSMUSG00000023991
AA Change: R379Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 458 540 4.69e-38 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 659 671 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113263
AA Change: R377Q
SMART Domains Protein: ENSMUSP00000108888
Gene: ENSMUSG00000023991
AA Change: R377Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 171 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
ZnF_C2H2 311 336 3.47e0 SMART
FH 468 550 4.69e-38 SMART
low complexity region 642 656 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113265
AA Change: R378Q
SMART Domains Protein: ENSMUSP00000108890
Gene: ENSMUSG00000023991
AA Change: R378Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
internal_repeat_1 214 282 3.94e-5 PROSPERO
low complexity region 296 307 N/A INTRINSIC
ZnF_C2H2 312 337 3.47e0 SMART
FH 457 539 4.69e-38 SMART
internal_repeat_1 571 627 3.94e-5 PROSPERO
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154108
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die before E12.5. Foregut closure is delayed leading to the development of two beating hearts and to the failure of the trachea and esophagus to separate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Foxp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Foxp4 APN 17 47888153 missense probably damaging 1.00
IGL02454:Foxp4 APN 17 47875582 nonsense probably null
IGL03048:Foxp4 UTSW 17 47880840 missense unknown
R0138:Foxp4 UTSW 17 47869179 missense unknown
R1180:Foxp4 UTSW 17 47880353 splice site probably benign
R1268:Foxp4 UTSW 17 47880353 splice site probably benign
R1282:Foxp4 UTSW 17 47875643 missense unknown
R1494:Foxp4 UTSW 17 47880353 splice site probably benign
R1845:Foxp4 UTSW 17 47877959 missense probably null
R1956:Foxp4 UTSW 17 47875871 missense unknown
R1958:Foxp4 UTSW 17 47875871 missense unknown
R1969:Foxp4 UTSW 17 47875871 missense unknown
R1971:Foxp4 UTSW 17 47875871 missense unknown
R2240:Foxp4 UTSW 17 47871276 missense unknown
R3847:Foxp4 UTSW 17 47875528 missense unknown
R3848:Foxp4 UTSW 17 47875528 missense unknown
R3849:Foxp4 UTSW 17 47875528 missense unknown
R4345:Foxp4 UTSW 17 47874648 missense unknown
R5572:Foxp4 UTSW 17 47880879 missense unknown
R5726:Foxp4 UTSW 17 47869108 missense unknown
R6386:Foxp4 UTSW 17 47878462 missense unknown
R6510:Foxp4 UTSW 17 47875410 missense unknown
X0025:Foxp4 UTSW 17 47877965 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGGTCACCTTGGAGAATGAG -3'
(R):5'- AGGTATGTGCGTGCATATGC -3'

Sequencing Primer
(F):5'- CCTTGGAGAATGAGGAGGAGCC -3'
(R):5'- ATGCACAAGTGTGTATGTGTG -3'
Posted On2014-08-25