Incidental Mutation 'R1970:Myof'
ID219848
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 039983-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1970 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37945634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 955 (D955E)
Ref Sequence ENSEMBL: ENSMUSP00000153225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect probably damaging
Transcript: ENSMUST00000041475
AA Change: D942E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: D942E

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172095
AA Change: D942E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: D942E

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223650
Predicted Effect probably benign
Transcript: ENSMUST00000225159
AA Change: D426E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: D955E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nf1 A G 11: 79,553,961 N371D probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCACTGTCTAGTCAGAGACCTAG -3'
(R):5'- AGAAGGGAACTGGTGTCCTTC -3'

Sequencing Primer
(F):5'- GTCAGAGACCTAGTTTTTACTGGACC -3'
(R):5'- GAGTCTCCTGACAGTGTAAAATAGC -3'
Posted On2014-08-25