Incidental Mutation 'R2012:Adam22'
ID219898
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2012 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8117634 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 675 (S675R)
Ref Sequence ENSEMBL: ENSMUSP00000111046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388] [ENSMUST00000123168] [ENSMUST00000126384] [ENSMUST00000130315] [ENSMUST00000136524] [ENSMUST00000136808] [ENSMUST00000139048] [ENSMUST00000139841] [ENSMUST00000144241] [ENSMUST00000153427] [ENSMUST00000153889] [ENSMUST00000154935] [ENSMUST00000197700] [ENSMUST00000199853]
Predicted Effect probably damaging
Transcript: ENSMUST00000046838
AA Change: S675R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050166
AA Change: S675R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088744
AA Change: S675R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088761
AA Change: S675R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115386
AA Change: S675R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115388
AA Change: S675R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: S675R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123168
SMART Domains Protein: ENSMUSP00000122758
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124121
AA Change: S57R
SMART Domains Protein: ENSMUSP00000122652
Gene: ENSMUSG00000040537
AA Change: S57R

DomainStartEndE-ValueType
Blast:ACR 2 52 5e-28 BLAST
EGF 59 93 1.28e1 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126384
SMART Domains Protein: ENSMUSP00000118571
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130315
SMART Domains Protein: ENSMUSP00000121156
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 150 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136524
SMART Domains Protein: ENSMUSP00000116422
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 152 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136808
SMART Domains Protein: ENSMUSP00000122426
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139048
SMART Domains Protein: ENSMUSP00000116736
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139841
SMART Domains Protein: ENSMUSP00000115775
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 144 164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144241
SMART Domains Protein: ENSMUSP00000138353
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153427
SMART Domains Protein: ENSMUSP00000120995
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
low complexity region 209 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153889
SMART Domains Protein: ENSMUSP00000123196
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154935
SMART Domains Protein: ENSMUSP00000119409
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197700
SMART Domains Protein: ENSMUSP00000142580
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199853
SMART Domains Protein: ENSMUSP00000143097
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Aox3 A T 1: 58,138,232 Y202F probably benign Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Dync2h1 A T 9: 7,169,589 I296K probably benign Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Igf2 C A 7: 142,654,399 E106D probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
R7402:Adam22 UTSW 5 8095049 missense possibly damaging 0.95
R7431:Adam22 UTSW 5 8092818 missense probably damaging 1.00
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAAGTTAGTGTTCACATCTCAACC -3'
(R):5'- AGAAGTCCAGAGAAGCGATATTGTC -3'

Sequencing Primer
(F):5'- CAGAAACATGGATAATCACATGGTC -3'
(R):5'- GAGAAGCGATATTGTCTCCTTTTAG -3'
Posted On2014-08-25