Incidental Mutation 'R2012:Igf2'
ID219941
Institutional Source Beutler Lab
Gene Symbol Igf2
Ensembl Gene ENSMUSG00000048583
Gene Nameinsulin-like growth factor 2
SynonymsM6pr, Mpr, Igf-2, Igf-II, Peg2
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R2012 (G1)
Quality Score180
Status Not validated
Chromosome7
Chromosomal Location142650766-142666816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142654399 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 106 (E106D)
Ref Sequence ENSEMBL: ENSMUSP00000136786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000033] [ENSMUST00000097936] [ENSMUST00000105935] [ENSMUST00000105936] [ENSMUST00000121128] [ENSMUST00000145896] [ENSMUST00000178921] [ENSMUST00000228850]
Predicted Effect probably damaging
Transcript: ENSMUST00000000033
AA Change: E69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000033
Gene: ENSMUSG00000048583
AA Change: E69D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093631
Predicted Effect probably damaging
Transcript: ENSMUST00000097936
AA Change: E69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095549
Gene: ENSMUSG00000048583
AA Change: E69D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105935
AA Change: E69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101555
Gene: ENSMUSG00000048583
AA Change: E69D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105936
AA Change: E69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101556
Gene: ENSMUSG00000048583
AA Change: E69D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Pfam:IGF2_C 112 166 3.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121128
AA Change: E80D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114076
Gene: ENSMUSG00000048583
AA Change: E80D

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IlGF 41 95 2.09e-22 SMART
Pfam:IGF2_C 123 177 6.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143666
Predicted Effect probably damaging
Transcript: ENSMUST00000145896
AA Change: E69D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122653
Gene: ENSMUSG00000048583
AA Change: E69D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 30 84 2.09e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163148
Predicted Effect probably damaging
Transcript: ENSMUST00000178921
AA Change: E106D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136786
Gene: ENSMUSG00000048583
AA Change: E106D

DomainStartEndE-ValueType
IlGF 67 121 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228850
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mutations that are paternally transmitted result in growth deficiency. Heterozygous mice inheriting a mutant allele from their mother appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A T 5: 8,117,634 S675R probably damaging Het
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Aox3 A T 1: 58,138,232 Y202F probably benign Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Dync2h1 A T 9: 7,169,589 I296K probably benign Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Igf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Igf2 APN 7 142654048 missense probably benign 0.09
R4024:Igf2 UTSW 7 142654307 missense probably benign 0.23
R4275:Igf2 UTSW 7 142655786 missense probably benign 0.00
R5247:Igf2 UTSW 7 142653931 missense possibly damaging 0.90
R5825:Igf2 UTSW 7 142653855 missense probably damaging 0.97
R6185:Igf2 UTSW 7 142658381 missense possibly damaging 0.95
R7286:Igf2 UTSW 7 142655818 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCGTGGTACCCCAAATCAAGAAG -3'
(R):5'- TTCTACCACATCCCTGCAGG -3'

Sequencing Primer
(F):5'- CCCAAATCAAGAAGTGAGTGGTCTC -3'
(R):5'- TAGTATCCGGCCAGGGTCTAG -3'
Posted On2014-08-25