Incidental Mutation 'R2012:Dync2h1'
ID219962
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2012 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7169589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 296 (I296K)
Ref Sequence ENSEMBL: ENSMUSP00000120322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000139115] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: I296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: I296K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139115
AA Change: I296K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120322
Gene: ENSMUSG00000047193
AA Change: I296K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 676 3.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: I296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: I296K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147056
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: I296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: I296K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A T 5: 8,117,634 S675R probably damaging Het
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Aox3 A T 1: 58,138,232 Y202F probably benign Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Igf2 C A 7: 142,654,399 E106D probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CGTAAAATGCCTTCACAGACAAGTG -3'
(R):5'- AATCTAAGGGTGGGCTGGTC -3'

Sequencing Primer
(F):5'- GTGAAAACCCACTTCCACTTAAAG -3'
(R):5'- CGTATTTTGTGGTGGTTAATGTGC -3'
Posted On2014-08-25