Incidental Mutation 'R2012:Recql5'
ID219998
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R2012 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115897097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 465 (N465K)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131566] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000142089] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: N465K

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: N465K

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131566
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142089
SMART Domains Protein: ENSMUSP00000138928
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A T 5: 8,117,634 S675R probably damaging Het
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Aox3 A T 1: 58,138,232 Y202F probably benign Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Dync2h1 A T 9: 7,169,589 I296K probably benign Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Igf2 C A 7: 142,654,399 E106D probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATACCTAAAGGACAGGCTAGG -3'
(R):5'- AGGATGAGCCAACACTAGCC -3'

Sequencing Primer
(F):5'- ATGCAGGGGCTCTGTCCTTC -3'
(R):5'- GCACTCACTGCCTGTTCTAG -3'
Posted On2014-08-25