Incidental Mutation 'R2023:Casp8ap2'
ID220097
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 040032-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2023 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32644560 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1211 (V1211A)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: V1211A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: V1211A

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: V1211A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: V1211A

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,531,534 noncoding transcript Het
9930111J21Rik1 A G 11: 48,948,420 S447P possibly damaging Het
9930111J21Rik2 A G 11: 49,020,317 F430L probably benign Het
Acap2 A G 16: 31,119,415 V297A probably damaging Het
Adam3 G A 8: 24,689,463 R613C possibly damaging Het
Akt1 C T 12: 112,659,637 R67Q probably benign Het
Ambp T C 4: 63,151,465 Y108C probably damaging Het
Apob A G 12: 8,011,090 I3158V probably benign Het
Bank1 T C 3: 136,325,918 T8A probably benign Het
Ccdc88a G T 11: 29,463,546 E695* probably null Het
Cep68 A C 11: 20,239,888 S375A probably benign Het
Cfap44 A G 16: 44,416,012 I417V probably benign Het
Chrna2 T A 14: 66,142,228 H5Q probably benign Het
Cog7 A T 7: 121,936,970 I549K probably damaging Het
Col28a1 C A 6: 8,083,783 S558I possibly damaging Het
Cyp4f14 A G 17: 32,906,531 I385T probably damaging Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm5616 A G 9: 48,450,628 noncoding transcript Het
Gm5709 T C 3: 59,635,721 noncoding transcript Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Itpr3 T A 17: 27,102,811 M1054K possibly damaging Het
Kars T C 8: 112,001,852 N200S probably benign Het
Kdm2a C A 19: 4,322,464 R951L probably damaging Het
Ldhd T A 8: 111,629,946 H61L probably damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Micall2 A G 5: 139,717,511 V190A possibly damaging Het
Mis18bp1 A T 12: 65,149,109 V627E probably damaging Het
Muc4 A T 16: 32,752,254 T711S probably benign Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nox3 A G 17: 3,694,021 probably benign Het
Olfr32 G T 2: 90,138,856 C94* probably null Het
Olfr487 A G 7: 108,211,842 L229P probably damaging Het
Olfr786 T A 10: 129,437,582 Y257N probably damaging Het
Osbpl2 C A 2: 180,150,176 probably null Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Pgr T A 9: 8,958,398 V802D probably damaging Het
Pgs1 A G 11: 118,002,402 E55G probably benign Het
Pkd2 T A 5: 104,466,878 probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Ptprd C T 4: 75,957,104 E1240K probably damaging Het
Recql5 G A 11: 115,893,640 T878I probably benign Het
Rnf17 A G 14: 56,431,579 D233G possibly damaging Het
Sectm1a A G 11: 121,069,582 probably benign Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Srcin1 A G 11: 97,526,046 S931P probably benign Het
Tcof1 C T 18: 60,833,533 G329R probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Thsd7a G A 6: 12,327,536 H1446Y probably benign Het
Tlr11 A G 14: 50,362,569 T671A probably damaging Het
Tmem171 C A 13: 98,692,225 W139L probably damaging Het
Vmn2r101 C T 17: 19,590,106 R385* probably null Het
Vps13c A T 9: 67,936,285 probably benign Het
Zfp287 A C 11: 62,714,982 Y366* probably null Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp523 A G 17: 28,201,004 probably benign Het
Zfp667 A C 7: 6,305,417 K361N possibly damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTGACCGTTTATTTGAACAGCAAC -3'
(R):5'- CGGACTTAGCACTTGCATGC -3'

Sequencing Primer
(F):5'- CCGTTTATTTGAACAGCAACAAACAG -3'
(R):5'- ATGCTGTGCCGCCTGTG -3'
Posted On2014-08-25