Incidental Mutation 'R2023:Mis18bp1'
ID220172
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene NameMIS18 binding protein 1
SynonymsC79407
MMRRC Submission 040032-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R2023 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65132734-65172604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65149109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 627 (V627E)
Ref Sequence ENSEMBL: ENSMUSP00000052109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000221296] [ENSMUST00000222244]
Predicted Effect probably damaging
Transcript: ENSMUST00000052201
AA Change: V627E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: V627E

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149986
Predicted Effect probably benign
Transcript: ENSMUST00000221296
Predicted Effect probably benign
Transcript: ENSMUST00000222244
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,531,534 noncoding transcript Het
9930111J21Rik1 A G 11: 48,948,420 S447P possibly damaging Het
9930111J21Rik2 A G 11: 49,020,317 F430L probably benign Het
Acap2 A G 16: 31,119,415 V297A probably damaging Het
Adam3 G A 8: 24,689,463 R613C possibly damaging Het
Akt1 C T 12: 112,659,637 R67Q probably benign Het
Ambp T C 4: 63,151,465 Y108C probably damaging Het
Apob A G 12: 8,011,090 I3158V probably benign Het
Bank1 T C 3: 136,325,918 T8A probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc88a G T 11: 29,463,546 E695* probably null Het
Cep68 A C 11: 20,239,888 S375A probably benign Het
Cfap44 A G 16: 44,416,012 I417V probably benign Het
Chrna2 T A 14: 66,142,228 H5Q probably benign Het
Cog7 A T 7: 121,936,970 I549K probably damaging Het
Col28a1 C A 6: 8,083,783 S558I possibly damaging Het
Cyp4f14 A G 17: 32,906,531 I385T probably damaging Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm5616 A G 9: 48,450,628 noncoding transcript Het
Gm5709 T C 3: 59,635,721 noncoding transcript Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Itpr3 T A 17: 27,102,811 M1054K possibly damaging Het
Kars T C 8: 112,001,852 N200S probably benign Het
Kdm2a C A 19: 4,322,464 R951L probably damaging Het
Ldhd T A 8: 111,629,946 H61L probably damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Micall2 A G 5: 139,717,511 V190A possibly damaging Het
Muc4 A T 16: 32,752,254 T711S probably benign Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nox3 A G 17: 3,694,021 probably benign Het
Olfr32 G T 2: 90,138,856 C94* probably null Het
Olfr487 A G 7: 108,211,842 L229P probably damaging Het
Olfr786 T A 10: 129,437,582 Y257N probably damaging Het
Osbpl2 C A 2: 180,150,176 probably null Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Pgr T A 9: 8,958,398 V802D probably damaging Het
Pgs1 A G 11: 118,002,402 E55G probably benign Het
Pkd2 T A 5: 104,466,878 probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Ptprd C T 4: 75,957,104 E1240K probably damaging Het
Recql5 G A 11: 115,893,640 T878I probably benign Het
Rnf17 A G 14: 56,431,579 D233G possibly damaging Het
Sectm1a A G 11: 121,069,582 probably benign Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Srcin1 A G 11: 97,526,046 S931P probably benign Het
Tcof1 C T 18: 60,833,533 G329R probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Thsd7a G A 6: 12,327,536 H1446Y probably benign Het
Tlr11 A G 14: 50,362,569 T671A probably damaging Het
Tmem171 C A 13: 98,692,225 W139L probably damaging Het
Vmn2r101 C T 17: 19,590,106 R385* probably null Het
Vps13c A T 9: 67,936,285 probably benign Het
Zfp287 A C 11: 62,714,982 Y366* probably null Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp523 A G 17: 28,201,004 probably benign Het
Zfp667 A C 7: 6,305,417 K361N possibly damaging Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65158441 missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65148989 missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65138678 missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65136748 critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65136831 nonsense probably null
IGL02318:Mis18bp1 APN 12 65158741 missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65161460 missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65153880 nonsense probably null
IGL02838:Mis18bp1 APN 12 65136826 missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65161930 missense probably benign
PIT4453001:Mis18bp1 UTSW 12 65158673 missense probably damaging 0.98
R0555:Mis18bp1 UTSW 12 65161453 missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65143283 nonsense probably null
R1517:Mis18bp1 UTSW 12 65133813 missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65161744 missense probably benign
R1705:Mis18bp1 UTSW 12 65149339 missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65149076 nonsense probably null
R1990:Mis18bp1 UTSW 12 65158694 missense probably benign 0.03
R2043:Mis18bp1 UTSW 12 65149418 missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65140843 missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65133586 missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65156988 splice site probably null
R3845:Mis18bp1 UTSW 12 65149142 missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65153881 missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65158506 missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65153529 intron probably benign
R4626:Mis18bp1 UTSW 12 65140766 missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65158739 missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R4875:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65149375 missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65157043 missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65148746 missense possibly damaging 0.83
R5560:Mis18bp1 UTSW 12 65152816 missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65154776 missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65148852 missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65158408 missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65149163 missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65138787 missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65149247 missense probably benign 0.11
R6418:Mis18bp1 UTSW 12 65158543 missense possibly damaging 0.64
R7103:Mis18bp1 UTSW 12 65149283 missense possibly damaging 0.61
X0058:Mis18bp1 UTSW 12 65149226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGATCGAGGTCTCTTTGGTG -3'
(R):5'- CTCCAAGTTCTACCAGTAAGTCTC -3'

Sequencing Primer
(F):5'- GGTGTGATATAACAAGCTCTCTCACC -3'
(R):5'- CTCAAGAGACCTTTGAACATAGAGTG -3'
Posted On2014-08-25