Incidental Mutation 'R2023:Cfap44'
ID220192
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission 040032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2023 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44416012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 417 (I417V)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably benign
Transcript: ENSMUST00000099742
AA Change: I417V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: I417V

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120049
AA Change: I417V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: I417V

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142648
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,531,534 noncoding transcript Het
9930111J21Rik1 A G 11: 48,948,420 S447P possibly damaging Het
9930111J21Rik2 A G 11: 49,020,317 F430L probably benign Het
Acap2 A G 16: 31,119,415 V297A probably damaging Het
Adam3 G A 8: 24,689,463 R613C possibly damaging Het
Akt1 C T 12: 112,659,637 R67Q probably benign Het
Ambp T C 4: 63,151,465 Y108C probably damaging Het
Apob A G 12: 8,011,090 I3158V probably benign Het
Bank1 T C 3: 136,325,918 T8A probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc88a G T 11: 29,463,546 E695* probably null Het
Cep68 A C 11: 20,239,888 S375A probably benign Het
Chrna2 T A 14: 66,142,228 H5Q probably benign Het
Cog7 A T 7: 121,936,970 I549K probably damaging Het
Col28a1 C A 6: 8,083,783 S558I possibly damaging Het
Cyp4f14 A G 17: 32,906,531 I385T probably damaging Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm5616 A G 9: 48,450,628 noncoding transcript Het
Gm5709 T C 3: 59,635,721 noncoding transcript Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Itpr3 T A 17: 27,102,811 M1054K possibly damaging Het
Kars T C 8: 112,001,852 N200S probably benign Het
Kdm2a C A 19: 4,322,464 R951L probably damaging Het
Ldhd T A 8: 111,629,946 H61L probably damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Micall2 A G 5: 139,717,511 V190A possibly damaging Het
Mis18bp1 A T 12: 65,149,109 V627E probably damaging Het
Muc4 A T 16: 32,752,254 T711S probably benign Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nox3 A G 17: 3,694,021 probably benign Het
Olfr32 G T 2: 90,138,856 C94* probably null Het
Olfr487 A G 7: 108,211,842 L229P probably damaging Het
Olfr786 T A 10: 129,437,582 Y257N probably damaging Het
Osbpl2 C A 2: 180,150,176 probably null Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Pgr T A 9: 8,958,398 V802D probably damaging Het
Pgs1 A G 11: 118,002,402 E55G probably benign Het
Pkd2 T A 5: 104,466,878 probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Ptprd C T 4: 75,957,104 E1240K probably damaging Het
Recql5 G A 11: 115,893,640 T878I probably benign Het
Rnf17 A G 14: 56,431,579 D233G possibly damaging Het
Sectm1a A G 11: 121,069,582 probably benign Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Srcin1 A G 11: 97,526,046 S931P probably benign Het
Tcof1 C T 18: 60,833,533 G329R probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Thsd7a G A 6: 12,327,536 H1446Y probably benign Het
Tlr11 A G 14: 50,362,569 T671A probably damaging Het
Tmem171 C A 13: 98,692,225 W139L probably damaging Het
Vmn2r101 C T 17: 19,590,106 R385* probably null Het
Vps13c A T 9: 67,936,285 probably benign Het
Zfp287 A C 11: 62,714,982 Y366* probably null Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp523 A G 17: 28,201,004 probably benign Het
Zfp667 A C 7: 6,305,417 K361N possibly damaging Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACCCTTTAACGGCTGAGC -3'
(R):5'- TTGGTTAAAATGAGGGCCAGC -3'

Sequencing Primer
(F):5'- ACAGGGTCTCACTGTCAAATTCTGG -3'
(R):5'- GTTAAAATGAGGGCCAGCAACACC -3'
Posted On2014-08-25