Incidental Mutation 'R1983:Filip1l'
ID220233
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Namefilamin A interacting protein 1-like
Synonyms
MMRRC Submission 039995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1983 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57353093-57573126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57571274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 742 (S742P)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159414
AA Change: S504P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: S504P

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159816
AA Change: S742P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: S742P

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 D273G probably null Het
Aco1 G A 4: 40,175,845 G160S probably benign Het
Actn2 C T 13: 12,278,810 R608H probably benign Het
Adora2a A C 10: 75,333,646 S315R probably benign Het
Arhgap42 T C 9: 9,017,017 Y382C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c A G 4: 99,228,575 Y318C probably damaging Het
Baz2a C T 10: 128,123,959 T1408I probably benign Het
Bbx T A 16: 50,209,117 Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 L264R probably damaging Het
Cfi T C 3: 129,868,545 I391T probably damaging Het
Chadl T C 15: 81,693,896 I45V probably benign Het
Chd5 C A 4: 152,384,666 A1853D possibly damaging Het
Cmas G T 6: 142,770,586 D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 F714L probably benign Het
Dguok A T 6: 83,487,128 Y126* probably null Het
Dnaic1 A G 4: 41,603,232 K172E probably benign Het
Dnaic2 T A 11: 114,735,856 probably null Het
Efcab6 A T 15: 83,892,962 probably benign Het
Eln A T 5: 134,736,340 probably null Het
Epor T C 9: 21,959,400 T395A probably benign Het
Evc2 G T 5: 37,415,931 E996* probably null Het
Fam124b T A 1: 80,213,647 E6D probably benign Het
Fam208b G T 13: 3,574,853 T1699K possibly damaging Het
Filip1 T A 9: 79,860,092 K146N probably damaging Het
Fsip2 G T 2: 82,979,831 V2165L probably benign Het
Gcdh A T 8: 84,890,910 V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 N336S probably benign Het
Gm12695 G T 4: 96,738,977 A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 V81E unknown Het
Gpr137c T C 14: 45,279,971 V388A probably benign Het
Hgf A G 5: 16,561,012 T49A possibly damaging Het
Hspa1a G T 17: 34,970,962 R322S probably benign Het
Jak3 A T 8: 71,678,375 Q13L possibly damaging Het
Jak3 A G 8: 71,688,136 R1098G probably benign Het
Kif11 C T 19: 37,390,776 T305I possibly damaging Het
Lcor T A 19: 41,558,367 V130E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 probably null Het
Mdga1 G A 17: 29,850,605 R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 probably null Het
Mmp27 T A 9: 7,578,897 probably null Het
Mtnr1a A T 8: 45,087,434 N144I probably benign Het
Mycbp2 T C 14: 103,145,971 T3563A probably damaging Het
Myef2 T A 2: 125,098,845 M355L probably benign Het
Olfr1065 T A 2: 86,445,076 H302L probably benign Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr1457 A G 19: 13,095,384 I88T probably benign Het
Olfr470 C T 7: 107,845,412 G107D probably benign Het
Parg A G 14: 32,217,696 K560E probably damaging Het
Pck2 G A 14: 55,544,068 probably null Het
Pdcd6 T C 13: 74,304,000 I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 P74Q probably benign Het
Prdm4 T C 10: 85,907,953 Y146C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prune2 A G 19: 17,020,642 M248V probably damaging Het
Ric8b T A 10: 85,001,838 M503K probably damaging Het
Ror2 C T 13: 53,110,408 V871M probably benign Het
Ryr1 T C 7: 29,059,472 N3427S possibly damaging Het
Ryr2 A G 13: 11,585,402 probably null Het
Scimp C T 11: 70,800,714 V30I probably damaging Het
Skint4 A G 4: 112,146,492 E374G probably benign Het
Slc6a20a A G 9: 123,640,587 Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Strc T A 2: 121,371,037 M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 Y226C probably damaging Het
Tex10 A T 4: 48,460,059 L431I possibly damaging Het
Tnc A G 4: 63,984,630 V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 I248T possibly damaging Het
Ttn T A 2: 76,756,760 K21631M probably damaging Het
Ttn T C 2: 76,789,025 N16031S possibly damaging Het
Uroc1 A T 6: 90,345,369 S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 M233L probably benign Het
Wdr31 A T 4: 62,460,603 M129K probably damaging Het
Wnk1 A T 6: 119,937,578 N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 Q1063* probably null Het
Zfp799 C A 17: 32,822,110 V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 D874E possibly damaging Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 intron probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAAGATGGAGCTTGC -3'
(R):5'- TAGTCTGGTGGCTCACTGTC -3'

Sequencing Primer
(F):5'- GCTTGCCAAGTACAAGTTGG -3'
(R):5'- GTGGCTCACTGTCTGCTGC -3'
Posted On2014-08-25