Incidental Mutation 'R1984:Igfn1'
ID220261
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
Synonyms9830123M21Rik
MMRRC Submission 039996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1984 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135962044 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2422 (S2422P)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect unknown
Transcript: ENSMUST00000124134
AA Change: S806P
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: S806P

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000140703
AA Change: S48P
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: S2422P

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: S2422P

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,819 L81H probably damaging Het
Abca8b A G 11: 109,977,841 C166R probably damaging Het
Adgrv1 T A 13: 81,523,749 E2242D probably damaging Het
Agap1 T C 1: 89,766,323 S448P probably benign Het
AI464131 C A 4: 41,497,501 A710S possibly damaging Het
Aldh1a2 T C 9: 71,253,052 L120P probably damaging Het
Alkbh2 T C 5: 114,124,054 N205S probably benign Het
Anapc1 C A 2: 128,669,688 G493C possibly damaging Het
Aox3 A T 1: 58,153,061 I497F possibly damaging Het
Atp2b1 T C 10: 99,014,492 S826P possibly damaging Het
Atp8b4 T A 2: 126,323,008 R1129S probably damaging Het
Bche T A 3: 73,701,826 Q89L probably benign Het
Bche G T 3: 73,701,827 Q89K probably benign Het
Bcl9 T C 3: 97,213,734 K171E probably damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Dock8 A G 19: 25,121,181 N623S probably null Het
Dok6 T C 18: 89,560,110 E61G probably damaging Het
Esf1 A T 2: 140,148,886 D559E possibly damaging Het
F11r A G 1: 171,461,870 I254V probably benign Het
Fkrp A G 7: 16,811,877 V20A probably benign Het
Fscb T C 12: 64,474,683 E3G unknown Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4981 T A 10: 58,235,963 Q143L possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Isg15 T C 4: 156,199,793 I93V probably benign Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
March6 A T 15: 31,469,646 L726Q probably damaging Het
Megf6 G T 4: 154,267,667 G1210C probably damaging Het
Msh2 C T 17: 87,719,296 T740I probably damaging Het
Myh14 T C 7: 44,639,022 Y514C probably damaging Het
Nedd1 T C 10: 92,714,160 T88A possibly damaging Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Obox1 A T 7: 15,555,210 I17L probably benign Het
Olfr739 A T 14: 50,425,391 I291L possibly damaging Het
Palb2 A C 7: 122,127,080 H522Q probably damaging Het
Pde4c C T 8: 70,724,542 T6M probably damaging Het
Plekhg1 A G 10: 3,958,181 K97E probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Qrich1 T C 9: 108,534,047 V257A probably damaging Het
Rpl14 A G 9: 120,572,187 D32G possibly damaging Het
Senp8 A G 9: 59,737,438 V132A possibly damaging Het
Serac1 A G 17: 6,045,689 probably null Het
Sh2d3c T A 2: 32,749,244 C295* probably null Het
Stab1 A G 14: 31,150,648 F1142L probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A G 15: 66,682,842 E702G probably benign Het
Tgif2lx2 A T X: 118,427,993 K218* probably null Het
Tpp1 C A 7: 105,751,698 V41L probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp683 T C 4: 134,057,455 F338L probably damaging Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1626:Igfn1 UTSW 1 135968967 missense probably benign 0.29
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135998625 missense probably benign
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135964826 missense probably benign
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R5966:Igfn1 UTSW 1 135965414 missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTGGCCTTTCAACCTTGAC -3'
(R):5'- AACTCTGTCACACCTGGTTG -3'

Sequencing Primer
(F):5'- AACCTTGACTTCCAGCTCTTTAG -3'
(R):5'- GCTGTGTTAGACCCCACGTTTG -3'
Posted On2014-08-25