Incidental Mutation 'R1985:Prickle2'
ID220449
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92411452 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 323 (D323G)
Ref Sequence ENSEMBL: ENSMUSP00000109074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect probably benign
Transcript: ENSMUST00000032093
AA Change: D379G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: D379G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113445
AA Change: D323G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: D323G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113446
AA Change: D323G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: D323G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113447
AA Change: D323G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: D323G

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp788 T A 7: 41,650,481 I795N probably damaging Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0555:Prickle2 UTSW 6 92458565 missense probably benign 0.02
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R2085:Prickle2 UTSW 6 92376364 missense probably damaging 0.96
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R3547:Prickle2 UTSW 6 92411137 missense probably damaging 1.00
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5280:Prickle2 UTSW 6 92376210 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGAGATCCATCTGCACTG -3'
(R):5'- GTATTGTGGTGCTCAGCCAG -3'

Sequencing Primer
(F):5'- GAGATCCATCTGCACTGACAGG -3'
(R):5'- TTGCTTCCCAGGAATTGACCAAG -3'
Posted On2014-08-25