Incidental Mutation 'R0137:Phip'
ID22046
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission 038422-MU
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0137 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 82927191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787] [ENSMUST00000189985]
Predicted Effect probably null
Transcript: ENSMUST00000034787
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189927
Predicted Effect probably null
Transcript: ENSMUST00000189985
SMART Domains Protein: ENSMUSP00000140445
Gene: ENSMUSG00000032253

DomainStartEndE-ValueType
WD40 110 149 1.5e-8 SMART
WD40 152 191 4e-9 SMART
WD40 194 237 3.5e-7 SMART
WD40 248 287 1.4e-1 SMART
WD40 292 331 6.5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190405
Predicted Effect probably benign
Transcript: ENSMUST00000190822
Meta Mutation Damage Score 0.6564 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Nckap1l A T 15: 103,481,964 I721F probably benign Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rccd1 A G 7: 80,320,578 V97A possibly damaging Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Scg3 A T 9: 75,663,180 probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGTCAGCCTCAGCAGTACTCAAAG -3'
(R):5'- CCCGCAAAAGGATGAAGTCATTCCC -3'

Sequencing Primer
(F):5'- AGTTTGGGTTTTGTTTCTCACC -3'
(R):5'- GACATGAGCTTCTACTGAGCCATAG -3'
Posted On2013-04-12