Incidental Mutation 'R1985:Zfp788'
ID220460
Institutional Source Beutler Lab
Gene Symbol Zfp788
Ensembl Gene ENSMUSG00000074165
Gene Namezinc finger protein 788
Synonyms
MMRRC Submission 039997-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1985 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41633203-41651530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41650481 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 795 (I795N)
Ref Sequence ENSEMBL: ENSMUSP00000132848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045720] [ENSMUST00000098508] [ENSMUST00000100275] [ENSMUST00000131180] [ENSMUST00000140964] [ENSMUST00000154942] [ENSMUST00000170770]
Predicted Effect probably damaging
Transcript: ENSMUST00000045720
AA Change: I827N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035499
Gene: ENSMUSG00000074165
AA Change: I827N

DomainStartEndE-ValueType
KRAB 4 67 7.82e-17 SMART
ZnF_C2H2 218 240 2.53e-2 SMART
ZnF_C2H2 246 268 2.71e-2 SMART
ZnF_C2H2 274 296 8.47e-4 SMART
ZnF_C2H2 302 324 3.16e-3 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 4.54e-4 SMART
ZnF_C2H2 386 408 1.36e-2 SMART
ZnF_C2H2 414 436 2.24e-3 SMART
ZnF_C2H2 442 464 5.14e-3 SMART
ZnF_C2H2 470 492 5.14e-3 SMART
ZnF_C2H2 498 520 5.42e-2 SMART
ZnF_C2H2 526 548 8.6e-5 SMART
ZnF_C2H2 554 576 1.53e-1 SMART
ZnF_C2H2 582 604 2.4e-3 SMART
ZnF_C2H2 610 632 8.81e-2 SMART
ZnF_C2H2 638 660 9.58e-3 SMART
ZnF_C2H2 666 688 4.54e-4 SMART
ZnF_C2H2 694 716 1.1e-2 SMART
ZnF_C2H2 722 744 3.63e-3 SMART
ZnF_C2H2 750 772 8.94e-3 SMART
ZnF_C2H2 778 800 1.5e-4 SMART
ZnF_C2H2 806 828 4.24e-4 SMART
ZnF_C2H2 834 856 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098508
AA Change: I847N

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096108
Gene: ENSMUSG00000074165
AA Change: I847N

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
ZnF_C2H2 238 260 2.53e-2 SMART
ZnF_C2H2 266 288 2.71e-2 SMART
ZnF_C2H2 294 316 8.47e-4 SMART
ZnF_C2H2 322 344 3.16e-3 SMART
ZnF_C2H2 350 372 1.38e-3 SMART
ZnF_C2H2 378 400 4.54e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 2.24e-3 SMART
ZnF_C2H2 462 484 5.14e-3 SMART
ZnF_C2H2 490 512 5.14e-3 SMART
ZnF_C2H2 518 540 5.42e-2 SMART
ZnF_C2H2 546 568 8.6e-5 SMART
ZnF_C2H2 574 596 1.53e-1 SMART
ZnF_C2H2 602 624 2.4e-3 SMART
ZnF_C2H2 630 652 8.81e-2 SMART
ZnF_C2H2 658 680 9.58e-3 SMART
ZnF_C2H2 686 708 4.54e-4 SMART
ZnF_C2H2 714 736 1.1e-2 SMART
ZnF_C2H2 742 764 3.63e-3 SMART
ZnF_C2H2 770 792 8.94e-3 SMART
ZnF_C2H2 798 820 1.5e-4 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
ZnF_C2H2 854 876 5.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100275
AA Change: I795N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097847
Gene: ENSMUSG00000074165
AA Change: I795N

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131180
SMART Domains Protein: ENSMUSP00000114542
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140964
SMART Domains Protein: ENSMUSP00000116050
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154942
Predicted Effect probably damaging
Transcript: ENSMUST00000170770
AA Change: I795N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132848
Gene: ENSMUSG00000074165
AA Change: I795N

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (76/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik T A 10: 82,620,217 T37S possibly damaging Het
AA792892 A T 5: 94,384,072 I272L probably benign Het
Abhd8 C A 8: 71,463,513 probably benign Het
Adam5 A T 8: 24,746,739 D648E probably benign Het
Akr1d1 A G 6: 37,558,401 D240G probably damaging Het
Ankmy2 A G 12: 36,157,364 H3R possibly damaging Het
Anpep A C 7: 79,840,857 probably null Het
Apobr A G 7: 126,587,731 T20A possibly damaging Het
Atp2a2 A T 5: 122,466,836 Y427N probably benign Het
Camkk2 A C 5: 122,764,127 S40A possibly damaging Het
Camp T C 9: 109,848,429 N112S probably benign Het
Cbx7 A G 15: 79,918,390 S229P probably damaging Het
Cnot2 T C 10: 116,527,876 N41S probably damaging Het
Dchs1 A G 7: 105,772,398 F272L possibly damaging Het
Dct T C 14: 118,036,542 K318E probably benign Het
Dhrs11 A C 11: 84,828,807 L31V probably damaging Het
Dnah7a T C 1: 53,503,934 D2359G probably benign Het
Dnajc7 A G 11: 100,590,892 S305P probably benign Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Fam71b T C 11: 46,407,866 *666Q probably null Het
Flnc A G 6: 29,444,416 probably benign Het
Gm7535 A G 17: 17,911,538 probably benign Het
Grtp1 A G 8: 13,179,376 F313L probably damaging Het
Haus6 T C 4: 86,593,609 Y425C possibly damaging Het
Hdac1 T A 4: 129,528,960 N83Y possibly damaging Het
Hdlbp A G 1: 93,431,118 I237T probably damaging Het
Hfm1 A T 5: 106,898,576 D481E probably damaging Het
Hipk3 T C 2: 104,434,435 I737V probably benign Het
Il23r T A 6: 67,490,668 probably null Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Ints3 C T 3: 90,400,303 probably null Het
Kcna6 T C 6: 126,738,510 E472G probably benign Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kdm4b T A 17: 56,401,302 V957E probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Klhl11 G T 11: 100,463,244 Q584K probably benign Het
Krt9 A T 11: 100,189,991 M345K probably benign Het
Lgr5 T C 10: 115,495,245 probably benign Het
Lilr4b A T 10: 51,481,735 Q80L possibly damaging Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Ly9 A G 1: 171,599,773 S405P probably damaging Het
Myh2 A G 11: 67,180,914 D519G possibly damaging Het
Nav3 G A 10: 109,770,184 probably benign Het
Nfkb1 G A 3: 135,615,349 T215I possibly damaging Het
Ninj2 A T 6: 120,198,639 probably benign Het
Obsl1 A G 1: 75,505,600 C209R probably damaging Het
Olfr1393 T C 11: 49,280,283 I45T probably damaging Het
Olfr314 A C 11: 58,786,384 D50A probably damaging Het
Olfr531 A T 7: 140,400,800 M82K possibly damaging Het
Olfr539 G A 7: 140,667,821 C171Y probably damaging Het
Olfr619 A T 7: 103,603,672 Y6F probably benign Het
Olfr710 A G 7: 106,944,926 I25T probably benign Het
Otud4 G C 8: 79,640,012 R36P probably damaging Het
Pcnt C T 10: 76,380,337 R2239H possibly damaging Het
Pgbd5 T A 8: 124,370,592 M491L probably benign Het
Pitrm1 A T 13: 6,558,184 D316V probably damaging Het
Plod3 A G 5: 136,990,853 probably null Het
Plppr3 A T 10: 79,867,460 Y63* probably null Het
Prickle2 T C 6: 92,411,452 D323G probably damaging Het
Psmd11 A T 11: 80,445,263 I114F probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbp3 T G 14: 33,956,461 S789A probably benign Het
Rfxap C A 3: 54,807,326 R117L probably damaging Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Scin A G 12: 40,133,908 probably null Het
Scn11a A G 9: 119,754,678 S1624P probably benign Het
Slc41a3 G A 6: 90,642,228 V330M probably damaging Het
Slc9c1 A G 16: 45,550,106 I237V probably benign Het
Spag6 A G 2: 18,732,119 I218V probably benign Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Tbc1d24 G A 17: 24,207,964 R318* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Trpm3 T A 19: 22,926,082 Y1069N possibly damaging Het
Tuba8 A G 6: 121,220,520 D47G probably benign Het
Tulp3 A T 6: 128,326,806 S277T probably benign Het
Wdr7 GTT GT 18: 63,760,583 probably null Het
Ybx2 A G 11: 69,936,468 probably null Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Zfp788
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0207:Zfp788 UTSW 7 41649596 missense probably damaging 1.00
R0320:Zfp788 UTSW 7 41649547 missense probably damaging 1.00
R0608:Zfp788 UTSW 7 41648281 missense possibly damaging 0.53
R1184:Zfp788 UTSW 7 41648326 missense probably damaging 1.00
R1483:Zfp788 UTSW 7 41649075 nonsense probably null
R2030:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R2207:Zfp788 UTSW 7 41649640 missense probably damaging 0.99
R2313:Zfp788 UTSW 7 41648888 missense probably damaging 0.99
R3791:Zfp788 UTSW 7 41649728 missense probably damaging 0.99
R3872:Zfp788 UTSW 7 41649444 nonsense probably null
R4126:Zfp788 UTSW 7 41649436 missense probably damaging 0.97
R4579:Zfp788 UTSW 7 41647594 missense probably benign 0.00
R4833:Zfp788 UTSW 7 41647568 missense probably benign 0.31
R5076:Zfp788 UTSW 7 41648584 missense possibly damaging 0.93
R5175:Zfp788 UTSW 7 41649329 missense probably damaging 1.00
R5225:Zfp788 UTSW 7 41649556 missense probably benign 0.16
R5364:Zfp788 UTSW 7 41650127 missense probably damaging 1.00
R5427:Zfp788 UTSW 7 41649652 missense possibly damaging 0.82
R5484:Zfp788 UTSW 7 41649853 missense probably damaging 0.96
R5659:Zfp788 UTSW 7 41650116 nonsense probably null
R5917:Zfp788 UTSW 7 41649148 missense probably benign
R6064:Zfp788 UTSW 7 41648454 missense probably benign 0.18
R6128:Zfp788 UTSW 7 41650361 missense probably damaging 1.00
R6144:Zfp788 UTSW 7 41649769 missense probably damaging 0.97
R6182:Zfp788 UTSW 7 41650516 missense probably damaging 0.98
R6299:Zfp788 UTSW 7 41648541 missense possibly damaging 0.81
R6823:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R6974:Zfp788 UTSW 7 41649877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATCCTTACTTCGAATGCATGAAAG -3'
(R):5'- CAGAAGGCTATCCCACTTTATACTC -3'

Sequencing Primer
(F):5'- ACTTCGAATGCATGAAAGAACTC -3'
(R):5'- ATTCTCCCAAATGAGATTTACCTCTC -3'
Posted On2014-08-25