Incidental Mutation 'R2025:Setd3'
ID220498
Institutional Source Beutler Lab
Gene Symbol Setd3
Ensembl Gene ENSMUSG00000056770
Gene NameSET domain containing 3
Synonyms2610305M23Rik, 2610102I01Rik, D12Ertd771e
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2025 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108106431-108179314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108160267 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 104 (E104V)
Ref Sequence ENSEMBL: ENSMUSP00000105505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071095] [ENSMUST00000109879] [ENSMUST00000125916] [ENSMUST00000132682] [ENSMUST00000147466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071095
AA Change: E104V

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066413
Gene: ENSMUSG00000056770
AA Change: E104V

DomainStartEndE-ValueType
Pfam:SET 105 314 2.1e-12 PFAM
Pfam:Rubis-subs-bind 345 475 3.7e-31 PFAM
low complexity region 565 577 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109879
AA Change: E104V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105505
Gene: ENSMUSG00000056770
AA Change: E104V

DomainStartEndE-ValueType
Pfam:SET 105 287 6.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125916
AA Change: E111V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122520
Gene: ENSMUSG00000056770
AA Change: E111V

DomainStartEndE-ValueType
PDB:3SMT|A 9 155 1e-100 PDB
Blast:SET 101 155 5e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132682
SMART Domains Protein: ENSMUSP00000123159
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147466
SMART Domains Protein: ENSMUSP00000121406
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169951
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Msh5 T A 17: 35,032,792 I431F possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Sbf1 T A 15: 89,302,730 E815V probably damaging Het
Slc39a5 A T 10: 128,398,410 L208Q probably damaging Het
Slc39a5 G T 10: 128,398,411 L208M probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnks2 C T 19: 36,866,066 L464F probably damaging Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Unc13a C T 8: 71,639,768 E1386K possibly damaging Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Setd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Setd3 APN 12 108160237 missense probably damaging 1.00
IGL01365:Setd3 APN 12 108157906 missense probably damaging 1.00
IGL02031:Setd3 APN 12 108163030 missense probably damaging 1.00
IGL02826:Setd3 APN 12 108112124 unclassified probably benign
IGL02878:Setd3 APN 12 108108555 critical splice donor site probably null
IGL03039:Setd3 APN 12 108162970 splice site probably null
R0332:Setd3 UTSW 12 108107579 missense probably benign
R1644:Setd3 UTSW 12 108113344 missense possibly damaging 0.88
R1776:Setd3 UTSW 12 108165161 missense probably damaging 1.00
R2018:Setd3 UTSW 12 108118254 missense probably damaging 1.00
R2041:Setd3 UTSW 12 108113392 missense possibly damaging 0.84
R2058:Setd3 UTSW 12 108107341 missense probably benign 0.03
R2206:Setd3 UTSW 12 108107285 missense probably benign 0.11
R2207:Setd3 UTSW 12 108107285 missense probably benign 0.11
R3973:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3976:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3978:Setd3 UTSW 12 108157942 missense possibly damaging 0.63
R4684:Setd3 UTSW 12 108108690 missense probably benign 0.05
R4965:Setd3 UTSW 12 108113371 missense probably benign 0.29
R5691:Setd3 UTSW 12 108160285 missense probably benign 0.19
R5990:Setd3 UTSW 12 108160335 missense probably benign
R6198:Setd3 UTSW 12 108165168 missense possibly damaging 0.66
R6241:Setd3 UTSW 12 108157855 missense probably benign 0.24
R6428:Setd3 UTSW 12 108113338 missense probably damaging 0.99
X0052:Setd3 UTSW 12 108107665 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TAGAATGCTGTCAGACTGAGGC -3'
(R):5'- AGCCATGTGATGAAATGTGTCC -3'

Sequencing Primer
(F):5'- CCCATGTGGTCAGATAAAGGCAC -3'
(R):5'- GCCATGTGATGAAATGTGTCCTAAAG -3'
Posted On2014-08-25