Mutagenetix > Incidental Mutation

Incidental Mutation 'R2025:Kalrn'

220528

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

E530005C20Rik, LOC224126, Hapip, 2210407G14Rik

MMRRC Submission

040034-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R2025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33789443-34393647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34010106 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 702 (I702V)

Ref Sequence

ENSEMBL: ENSMUSP00000110604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491] [ENSMUST00000114961]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076810
AA Change: I1316V

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: I1316V

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089655
AA Change: I1343V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: I1343V

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114947
AA Change: I689V

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: I689V

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114949
AA Change: I693V

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: I693V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: I702V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: I702V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: I702V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: I702V

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114960
AA Change: I1334V

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: I1334V

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151491
AA Change: I1090V

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: I1090V

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: I1311V

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: I1311V

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	T	C	14: 118,790,737 (GRCm39)	M757V	probably benign	Het
Abitram	T	A	4: 56,805,916 (GRCm39)	I138N	probably damaging	Het
Acan	T	G	7: 78,750,970 (GRCm39)	S1914A	probably benign	Het
Axin2	T	A	11: 108,833,904 (GRCm39)	V617D	probably damaging	Het
Bhlhe22	A	G	3: 18,109,975 (GRCm39)	S342G	probably benign	Het
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,723,108 (GRCm39)		probably null	Het
Ccdc34	A	G	2: 109,862,731 (GRCm39)	K179E	possibly damaging	Het
Clasp1	A	G	1: 118,432,629 (GRCm39)	T208A	probably damaging	Het
Crabp1	C	T	9: 54,675,752 (GRCm39)	R112*	probably null	Het
Cstdc1	T	C	2: 148,624,148 (GRCm39)	F41L	probably damaging	Het
D130040H23Rik	A	G	8: 69,755,525 (GRCm39)	N310S	probably benign	Het
Dalrd3	T	C	9: 108,448,284 (GRCm39)	I278T	probably benign	Het
Dbp	C	A	7: 45,357,700 (GRCm39)	D89E	probably benign	Het
Dennd2c	A	G	3: 103,039,005 (GRCm39)	D51G	possibly damaging	Het
Dido1	A	T	2: 180,330,974 (GRCm39)	L158*	probably null	Het
Disp1	G	T	1: 182,869,767 (GRCm39)	F884L	probably damaging	Het
Dmrtb1	T	C	4: 107,540,782 (GRCm39)	D193G	probably damaging	Het
Dnah8	A	G	17: 30,950,133 (GRCm39)	D1984G	probably damaging	Het
Dpf2	T	C	19: 5,952,781 (GRCm39)	Y218C	possibly damaging	Het
Dsg4	C	T	18: 20,599,693 (GRCm39)	Q770*	probably null	Het
Efemp1	A	T	11: 28,864,696 (GRCm39)	Y250F	possibly damaging	Het
Erbin	A	T	13: 103,966,703 (GRCm39)	I1249N	probably benign	Het
F5	A	G	1: 164,037,044 (GRCm39)	K1928E	probably benign	Het
Fhip1b	A	G	7: 105,038,143 (GRCm39)	V260A	probably damaging	Het
Gdf11	T	A	10: 128,727,314 (GRCm39)	I81F	probably damaging	Het
Gm10518	T	A	1: 179,631,483 (GRCm39)		probably benign	Het
Grb10	G	C	11: 11,920,576 (GRCm39)	S14*	probably null	Het
Greb1l	A	T	18: 10,515,221 (GRCm39)	Y562F	possibly damaging	Het
Gtf2ird1	T	C	5: 134,392,788 (GRCm39)	E789G	probably damaging	Het
Hook3	T	C	8: 26,528,126 (GRCm39)	E588G	probably damaging	Het
Hpx	A	G	7: 105,244,311 (GRCm39)	S266P	probably damaging	Het
Hs6st3	A	G	14: 120,106,801 (GRCm39)	D403G	probably damaging	Het
Igf2bp1	A	G	11: 95,864,996 (GRCm39)	V151A	possibly damaging	Het
Itga11	C	T	9: 62,670,093 (GRCm39)	T739I	probably damaging	Het
Kif2b	C	T	11: 91,468,172 (GRCm39)	S37N	probably damaging	Het
Kng2	T	A	16: 22,819,325 (GRCm39)	D237V	probably benign	Het
Krtap27-1	C	A	16: 88,468,173 (GRCm39)	V124L	possibly damaging	Het
Lig4	A	T	8: 10,022,436 (GRCm39)	L448Q	probably damaging	Het
Macf1	C	T	4: 123,265,711 (GRCm39)	A4821T	probably damaging	Het
Msh5	T	A	17: 35,251,768 (GRCm39)	I431F	possibly damaging	Het
Ndufa10	A	G	1: 92,367,614 (GRCm39)	Y339H	probably damaging	Het
Nin	T	A	12: 70,076,782 (GRCm39)	Q1091L	probably damaging	Het
Nom1	A	C	5: 29,651,849 (GRCm39)	D729A	probably damaging	Het
Or52e8	C	A	7: 104,624,451 (GRCm39)	G247V	probably benign	Het
P2ry14	A	T	3: 59,022,866 (GRCm39)	V207E	probably damaging	Het
Pdss2	A	T	10: 43,269,871 (GRCm39)	N238I	possibly damaging	Het
Pkn1	A	G	8: 84,398,007 (GRCm39)	V795A	probably damaging	Het
Pla2g6	A	C	15: 79,170,964 (GRCm39)	L804R	probably damaging	Het
Poglut1	A	T	16: 38,358,267 (GRCm39)		probably null	Het
Prkcz	A	T	4: 155,374,167 (GRCm39)	V83D	probably damaging	Het
Prss50	T	C	9: 110,690,328 (GRCm39)	F157S	probably benign	Het
Psors1c2	A	G	17: 35,845,099 (GRCm39)		probably benign	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Ptpro	T	A	6: 137,420,592 (GRCm39)	V1007D	probably damaging	Het
Pwwp4a	G	T	X: 72,171,261 (GRCm39)	G218C	probably damaging	Het
Rab7	G	A	6: 87,981,161 (GRCm39)	L174F	probably damaging	Het
Rapgef4	A	G	2: 72,073,083 (GRCm39)	T790A	probably benign	Het
Rb1cc1	G	T	1: 6,315,533 (GRCm39)	V503L	probably damaging	Het
Sbf1	T	A	15: 89,186,933 (GRCm39)	E815V	probably damaging	Het
Setd3	T	A	12: 108,126,526 (GRCm39)	E104V	probably damaging	Het
Slc39a5	A	T	10: 128,234,279 (GRCm39)	L208Q	probably damaging	Het
Slc39a5	G	T	10: 128,234,280 (GRCm39)	L208M	probably damaging	Het
Slc3a1	T	G	17: 85,340,273 (GRCm39)	Y232D	probably damaging	Het
Slc8a1	T	A	17: 81,956,541 (GRCm39)	S166C	probably damaging	Het
Stard9	T	A	2: 120,532,879 (GRCm39)	D3045E	probably benign	Het
Stk4	C	A	2: 163,938,751 (GRCm39)	D206E	probably damaging	Het
Syn3	T	C	10: 86,302,846 (GRCm39)	D103G	probably damaging	Het
Tbc1d30	T	A	10: 121,115,051 (GRCm39)	Y369F	probably benign	Het
Tenm2	G	T	11: 35,938,091 (GRCm39)	Y1527*	probably null	Het
Tfg	T	C	16: 56,525,988 (GRCm39)	K85R	possibly damaging	Het
Timp3	T	C	10: 86,136,749 (GRCm39)	L11P	probably damaging	Het
Tmem144	A	T	3: 79,735,018 (GRCm39)		probably null	Het
Tmtc4	T	C	14: 123,158,677 (GRCm39)	N682S	probably benign	Het
Tnks2	C	T	19: 36,843,466 (GRCm39)	L464F	probably damaging	Het
Trank1	T	C	9: 111,221,107 (GRCm39)	F2615L	probably benign	Het
Trio	T	C	15: 27,744,223 (GRCm39)	K2570E	probably damaging	Het
Trio	T	A	15: 27,774,013 (GRCm39)	D673V	probably damaging	Het
Ublcp1	A	T	11: 44,356,458 (GRCm39)	C87S	probably benign	Het
Unc13a	C	T	8: 72,092,412 (GRCm39)	E1386K	possibly damaging	Het
Wdr41	C	T	13: 95,155,456 (GRCm39)	H404Y	probably damaging	Het
Zfp280b	T	C	10: 75,874,328 (GRCm39)	L69S	probably damaging	Het
Zfp346	T	C	13: 55,280,121 (GRCm39)	S282P	probably damaging	Het
Zfp579	C	A	7: 4,996,520 (GRCm39)	E464*	probably null	Het
Zfp78	T	A	7: 6,378,513 (GRCm39)		probably null	Het
Zswim9	T	C	7: 13,003,292 (GRCm39)	E186G	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	33,996,092 (GRCm39)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,082,999 (GRCm39)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,055,700 (GRCm39)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,114,531 (GRCm39)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,018,882 (GRCm39)	splice site	probably null
IGL02059:Kalrn	APN	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,040,592 (GRCm39)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,130,897 (GRCm39)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,152,594 (GRCm39)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,181,216 (GRCm39)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,334,329 (GRCm39)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,040,484 (GRCm39)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,212,420 (GRCm39)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,040,500 (GRCm39)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,134,562 (GRCm39)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,205,667 (GRCm39)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,134,546 (GRCm39)	missense	probably damaging	0.99
breeze	UTSW	16	33,834,045 (GRCm39)	missense
ethereal	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
Feather	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
Hidden	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
Soulful	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,018,884 (GRCm39)	splice site	probably benign
R0043:Kalrn	UTSW	16	33,875,276 (GRCm39)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,177,541 (GRCm39)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	33,851,960 (GRCm39)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	33,870,306 (GRCm39)	intron	probably benign
R0183:Kalrn	UTSW	16	33,991,749 (GRCm39)	splice site	probably null
R0422:Kalrn	UTSW	16	34,134,643 (GRCm39)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	33,875,261 (GRCm39)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,814,040 (GRCm39)	splice site	probably benign
R0656:Kalrn	UTSW	16	33,852,837 (GRCm39)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	33,936,778 (GRCm39)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	33,830,951 (GRCm39)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	33,855,924 (GRCm39)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	33,870,289 (GRCm39)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,205,760 (GRCm39)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	33,836,868 (GRCm39)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,809,173 (GRCm39)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,033,190 (GRCm39)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,796,124 (GRCm39)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	33,994,857 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,134,648 (GRCm39)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	33,830,918 (GRCm39)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,181,320 (GRCm39)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,033,243 (GRCm39)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,114,585 (GRCm39)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,177,331 (GRCm39)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,796,293 (GRCm39)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,797,894 (GRCm39)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	33,848,415 (GRCm39)	missense	probably damaging	1.00
R2048:Kalrn	UTSW	16	34,072,680 (GRCm39)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,152,513 (GRCm39)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,152,600 (GRCm39)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,128,094 (GRCm39)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	33,829,632 (GRCm39)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	33,996,632 (GRCm39)	splice site	probably null
R2404:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,130,865 (GRCm39)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,032,642 (GRCm39)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,177,685 (GRCm39)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,212,400 (GRCm39)	splice site	probably null
R3788:Kalrn	UTSW	16	34,040,610 (GRCm39)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	33,860,259 (GRCm39)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,024,226 (GRCm39)	splice site	probably null
R3934:Kalrn	UTSW	16	34,130,901 (GRCm39)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,055,761 (GRCm39)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,807,578 (GRCm39)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,212,412 (GRCm39)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,055,637 (GRCm39)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,334,296 (GRCm39)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	33,849,075 (GRCm39)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	33,996,761 (GRCm39)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,018,857 (GRCm39)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,177,339 (GRCm39)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,334,389 (GRCm39)	unclassified	probably benign
R4888:Kalrn	UTSW	16	33,991,700 (GRCm39)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,177,785 (GRCm39)	splice site	probably null
R5030:Kalrn	UTSW	16	33,796,112 (GRCm39)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,134,722 (GRCm39)	nonsense	probably null
R5117:Kalrn	UTSW	16	33,853,971 (GRCm39)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,083,023 (GRCm39)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	33,873,992 (GRCm39)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	33,996,150 (GRCm39)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	33,860,304 (GRCm39)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	33,834,454 (GRCm39)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	33,836,949 (GRCm39)	missense	probably benign
R5716:Kalrn	UTSW	16	33,807,546 (GRCm39)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,796,190 (GRCm39)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,032,619 (GRCm39)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,807,461 (GRCm39)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,064,203 (GRCm39)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,177,713 (GRCm39)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	33,830,950 (GRCm39)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,181,255 (GRCm39)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,805,561 (GRCm39)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,033,255 (GRCm39)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,177,481 (GRCm39)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	33,874,009 (GRCm39)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	33,875,441 (GRCm39)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,796,361 (GRCm39)	missense	probably benign
R6397:Kalrn	UTSW	16	33,813,355 (GRCm39)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,152,534 (GRCm39)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,025,672 (GRCm39)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,181,354 (GRCm39)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,003,117 (GRCm39)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,038,293 (GRCm39)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,796,073 (GRCm39)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,040,506 (GRCm39)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,177,418 (GRCm39)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,038,261 (GRCm39)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,076,597 (GRCm39)	missense	unknown
R7154:Kalrn	UTSW	16	34,032,527 (GRCm39)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	33,983,447 (GRCm39)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	33,996,792 (GRCm39)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	33,996,131 (GRCm39)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,076,603 (GRCm39)	missense	unknown
R7563:Kalrn	UTSW	16	34,212,464 (GRCm39)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,134,582 (GRCm39)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,810,161 (GRCm39)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,809,217 (GRCm39)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	33,849,122 (GRCm39)	missense	probably benign
R8080:Kalrn	UTSW	16	33,796,038 (GRCm39)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	33,875,414 (GRCm39)	missense	probably benign
R8239:Kalrn	UTSW	16	33,870,153 (GRCm39)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	33,855,431 (GRCm39)	nonsense	probably null
R8294:Kalrn	UTSW	16	33,853,954 (GRCm39)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,181,305 (GRCm39)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	33,854,884 (GRCm39)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,803,225 (GRCm39)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,018,830 (GRCm39)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,038,305 (GRCm39)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,814,025 (GRCm39)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,047,496 (GRCm39)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	33,854,854 (GRCm39)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,181,371 (GRCm39)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	33,834,045 (GRCm39)	missense
R9424:Kalrn	UTSW	16	33,809,188 (GRCm39)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	33,916,249 (GRCm39)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,805,600 (GRCm39)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	33,849,197 (GRCm39)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,032,583 (GRCm39)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	33,860,303 (GRCm39)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	33,855,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTACTCGTGATACCTCTGCAG -3'
(R):5'- GGAGGGGCTATTTTAAGTAGCACTG -3'

Sequencing Primer
(F):5'- GTGATACCTCTGCAGCACCTG -3'
(R):5'- GCACTGGTTAGTCAATTACTGTAC -3'

Posted On

2014-08-25