Incidental Mutation 'R2025:Tnks2'
ID220554
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms
MMRRC Submission 040034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2025 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36834232-36893477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36866066 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 464 (L464F)
Ref Sequence ENSEMBL: ENSMUSP00000025729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729] [ENSMUST00000167724]
Predicted Effect probably damaging
Transcript: ENSMUST00000025729
AA Change: L464F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811
AA Change: L464F

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167533
Predicted Effect possibly damaging
Transcript: ENSMUST00000167724
AA Change: L116F

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126888
Gene: ENSMUSG00000024811
AA Change: L116F

DomainStartEndE-ValueType
ANK 84 113 4.89e-4 SMART
Blast:ANK 143 171 9e-10 BLAST
ANK 177 206 1.43e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168718
AA Change: L123F
SMART Domains Protein: ENSMUSP00000133253
Gene: ENSMUSG00000024811
AA Change: L123F

DomainStartEndE-ValueType
ANK 23 55 1.57e-2 SMART
ANK 59 88 4.5e-3 SMART
ANK 92 121 4.89e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T C 2: 148,782,228 F41L probably damaging Het
Abcc4 T C 14: 118,553,325 M757V probably benign Het
Acan T G 7: 79,101,222 S1914A probably benign Het
Axin2 T A 11: 108,943,078 V617D probably damaging Het
Bhlhe22 A G 3: 18,055,811 S342G probably benign Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Ccdc34 A G 2: 110,032,386 K179E possibly damaging Het
Clasp1 A G 1: 118,504,899 T208A probably damaging Het
Crabp1 C T 9: 54,768,468 R112* probably null Het
D130040H23Rik A G 8: 69,302,873 N310S probably benign Het
Dalrd3 T C 9: 108,571,085 I278T probably benign Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dennd2c A G 3: 103,131,689 D51G possibly damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Disp1 G T 1: 183,088,203 F884L probably damaging Het
Dmrtb1 T C 4: 107,683,585 D193G probably damaging Het
Dnah8 A G 17: 30,731,159 D1984G probably damaging Het
Dpf2 T C 19: 5,902,753 Y218C possibly damaging Het
Dsg4 C T 18: 20,466,636 Q770* probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Erbin A T 13: 103,830,195 I1249N probably benign Het
F5 A G 1: 164,209,475 K1928E probably benign Het
Fam160a2 A G 7: 105,388,936 V260A probably damaging Het
Fam206a T A 4: 56,805,916 I138N probably damaging Het
Gdf11 T A 10: 128,891,445 I81F probably damaging Het
Gm10518 T A 1: 179,803,918 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Grb10 G C 11: 11,970,576 S14* probably null Het
Greb1l A T 18: 10,515,221 Y562F possibly damaging Het
Gtf2ird1 T C 5: 134,363,934 E789G probably damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hpx A G 7: 105,595,104 S266P probably damaging Het
Hs6st3 A G 14: 119,869,389 D403G probably damaging Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Itga11 C T 9: 62,762,811 T739I probably damaging Het
Kalrn T C 16: 34,189,736 I702V probably damaging Het
Kif2b C T 11: 91,577,346 S37N probably damaging Het
Kng2 T A 16: 23,000,575 D237V probably benign Het
Krtap27-1 C A 16: 88,671,285 V124L possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Msh5 T A 17: 35,032,792 I431F possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nin T A 12: 70,030,008 Q1091L probably damaging Het
Nom1 A C 5: 29,446,851 D729A probably damaging Het
Olfr671 C A 7: 104,975,244 G247V probably benign Het
P2ry14 A T 3: 59,115,445 V207E probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pla2g6 A C 15: 79,286,764 L804R probably damaging Het
Poglut1 A T 16: 38,537,905 probably null Het
Prkcz A T 4: 155,289,710 V83D probably damaging Het
Prss50 T C 9: 110,861,260 F157S probably benign Het
Psors1c2 A G 17: 35,534,202 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab7 G A 6: 88,004,179 L174F probably damaging Het
Rapgef4 A G 2: 72,242,739 T790A probably benign Het
Rb1cc1 G T 1: 6,245,309 V503L probably damaging Het
Sbf1 T A 15: 89,302,730 E815V probably damaging Het
Setd3 T A 12: 108,160,267 E104V probably damaging Het
Slc39a5 A T 10: 128,398,410 L208Q probably damaging Het
Slc39a5 G T 10: 128,398,411 L208M probably damaging Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a1 T A 17: 81,649,112 S166C probably damaging Het
Stard9 T A 2: 120,702,398 D3045E probably benign Het
Stk4 C A 2: 164,096,831 D206E probably damaging Het
Syn3 T C 10: 86,466,982 D103G probably damaging Het
Tbc1d30 T A 10: 121,279,146 Y369F probably benign Het
Tenm2 G T 11: 36,047,264 Y1527* probably null Het
Tfg T C 16: 56,705,625 K85R possibly damaging Het
Timp3 T C 10: 86,300,885 L11P probably damaging Het
Tmem144 A T 3: 79,827,711 probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trank1 T C 9: 111,392,039 F2615L probably benign Het
Trio T C 15: 27,744,137 K2570E probably damaging Het
Trio T A 15: 27,773,927 D673V probably damaging Het
Ublcp1 A T 11: 44,465,631 C87S probably benign Het
Unc13a C T 8: 71,639,768 E1386K possibly damaging Het
Wdr41 C T 13: 95,018,948 H404Y probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp346 T C 13: 55,132,308 S282P probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp78 T A 7: 6,375,514 probably null Het
Zswim9 T C 7: 13,269,366 E186G probably damaging Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36871633 missense probably benign 0.00
IGL01977:Tnks2 APN 19 36872590 critical splice donor site probably null
IGL02389:Tnks2 APN 19 36884103 missense probably benign 0.32
IGL02653:Tnks2 APN 19 36872451 missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36845743 missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36852821 missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36849358 missense possibly damaging 0.51
R0591:Tnks2 UTSW 19 36872562 missense probably damaging 0.99
R0648:Tnks2 UTSW 19 36862074 splice site probably null
R0894:Tnks2 UTSW 19 36890050 critical splice donor site probably null
R1397:Tnks2 UTSW 19 36880501 splice site probably benign
R1459:Tnks2 UTSW 19 36845531 splice site probably benign
R1674:Tnks2 UTSW 19 36871622 missense probably benign 0.03
R1742:Tnks2 UTSW 19 36876261 missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36845668 nonsense probably null
R2898:Tnks2 UTSW 19 36872590 critical splice donor site probably null
R4422:Tnks2 UTSW 19 36845653 missense probably damaging 1.00
R4676:Tnks2 UTSW 19 36875271 nonsense probably null
R5202:Tnks2 UTSW 19 36888852 missense probably damaging 1.00
R5357:Tnks2 UTSW 19 36849290 splice site silent
R5467:Tnks2 UTSW 19 36881776 missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36862346 missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36879352 missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36866204 intron probably benign
R7270:Tnks2 UTSW 19 36859145 missense
R7309:Tnks2 UTSW 19 36852536 missense probably damaging 1.00
R7310:Tnks2 UTSW 19 36879439 missense probably benign 0.12
R7516:Tnks2 UTSW 19 36871664 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATGGTTTCAGGTGATGCAC -3'
(R):5'- AGAGTATGCTACTGAACAGAAGTC -3'

Sequencing Primer
(F):5'- TGATGCACCACCATGCTAATTTCAG -3'
(R):5'- ACACCTGCCATGTGAAGA -3'
Posted On2014-08-25