Incidental Mutation 'R1986:Tie1'
ID220614
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 039998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1986 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118478963 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 702 (R702H)
Ref Sequence ENSEMBL: ENSMUSP00000037129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably benign
Transcript: ENSMUST00000047421
AA Change: R702H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: R702H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably benign
Transcript: ENSMUST00000184261
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,419,328 S105P probably damaging Het
2610507B11Rik A T 11: 78,274,612 H1318L probably damaging Het
9930111J21Rik2 T A 11: 49,019,292 K771N possibly damaging Het
Abcc2 A G 19: 43,829,879 E1268G probably damaging Het
Adamts4 T C 1: 171,256,675 F574L possibly damaging Het
Adamts9 A G 6: 92,796,394 V1165A probably benign Het
Agap2 A T 10: 127,083,044 K430* probably null Het
Amn G T 12: 111,274,997 G232V probably damaging Het
Ank3 A G 10: 69,867,428 E297G probably damaging Het
Arhgap45 T C 10: 80,020,696 L26P probably damaging Het
Atp10b C A 11: 43,172,768 Q177K probably benign Het
Bbs10 A T 10: 111,299,257 D77V probably damaging Het
Bpifa1 T A 2: 154,144,336 L127Q probably damaging Het
Brinp2 T C 1: 158,246,778 N591S probably damaging Het
C2cd2 A C 16: 97,870,271 V476G probably damaging Het
C7 T A 15: 5,012,012 T471S possibly damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Cadps2 A G 6: 23,323,380 F1001L probably damaging Het
Ccdc188 T C 16: 18,218,843 S216P probably damaging Het
Ccdc24 A G 4: 117,872,016 L88P probably damaging Het
Dab1 T C 4: 104,613,215 I65T probably damaging Het
Dock4 A T 12: 40,730,063 D621V probably damaging Het
Drd5 A T 5: 38,320,113 M150L probably damaging Het
Eef2k T A 7: 120,873,346 M94K possibly damaging Het
Epg5 A G 18: 77,982,306 probably null Het
Epsti1 T C 14: 77,932,233 probably null Het
Ern2 T A 7: 122,171,529 D754V probably benign Het
Fam129c T A 8: 71,603,760 I368N possibly damaging Het
Fbxo6 A G 4: 148,146,095 Y237H probably damaging Het
Fbxw24 A G 9: 109,607,056 S303P probably damaging Het
Fpr-rs3 A T 17: 20,623,841 probably null Het
Gab1 G T 8: 80,766,381 T679K probably damaging Het
Gbp9 C A 5: 105,105,724 V42F probably damaging Het
Gbp9 A T 5: 105,105,786 V21E probably damaging Het
Gm14085 A G 2: 122,527,429 T655A probably benign Het
Gm20821 A G Y: 9,783,927 Q183R probably benign Het
Gpatch11 A T 17: 78,843,837 I226F probably benign Het
Hephl1 T G 9: 15,054,552 E1035A probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Ifna13 A G 4: 88,644,351 V12A probably benign Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Irgm2 A G 11: 58,219,558 D37G probably benign Het
Irs1 A G 1: 82,288,765 S577P probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Krtap4-16 T C 11: 99,851,496 Q26R unknown Het
Lig1 T A 7: 13,309,142 Y837* probably null Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Map3k20 C T 2: 72,441,294 Q589* probably null Het
Masp1 T G 16: 23,483,461 M347L probably benign Het
Mgat3 A T 15: 80,212,189 I406F probably benign Het
Mmp1b T G 9: 7,368,577 D425A probably benign Het
Mss51 T C 14: 20,483,191 H404R probably benign Het
Myo15b A T 11: 115,882,875 H1911L probably benign Het
Nedd4l A G 18: 65,143,803 D102G probably damaging Het
Npc2 T C 12: 84,760,749 K112E probably benign Het
Nuggc T A 14: 65,641,921 V694E probably damaging Het
Olfm1 T G 2: 28,214,706 V157G probably benign Het
Olfr476 T C 7: 107,967,670 V91A probably benign Het
Olfr63 T C 17: 33,269,515 S264P probably benign Het
Otogl T A 10: 107,794,190 probably null Het
Ovgp1 G A 3: 105,974,935 C38Y probably damaging Het
Pisd A T 5: 32,737,328 S344T probably damaging Het
Psme4 T C 11: 30,830,352 V840A probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Rin2 T A 2: 145,878,940 M731K probably damaging Het
Scgb1b19 T C 7: 33,287,683 probably null Het
Serpina10 A G 12: 103,628,255 I235T possibly damaging Het
Setbp1 T A 18: 78,858,544 E636V probably damaging Het
Sh3d21 C T 4: 126,162,497 E101K probably damaging Het
Ski T G 4: 155,221,691 D225A probably damaging Het
Slc29a3 T C 10: 60,723,814 Y187C probably damaging Het
Sort1 T A 3: 108,345,727 D494E possibly damaging Het
Sphkap A T 1: 83,277,922 L702Q probably damaging Het
Srr A G 11: 74,908,719 I285T probably damaging Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Suds3 A T 5: 117,108,352 N112K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tesk2 T C 4: 116,751,193 L104P probably damaging Het
Tpo G T 12: 30,119,466 A90E probably damaging Het
Trim30a T C 7: 104,411,465 D368G probably damaging Het
Ugt2a2 A T 5: 87,460,579 M633K possibly damaging Het
Vars2 A G 17: 35,660,061 W626R probably damaging Het
Vmn2r10 A T 5: 109,006,254 Y61* probably null Het
Vmn2r95 T C 17: 18,451,543 V514A probably benign Het
Vwa5a T G 9: 38,737,814 probably benign Het
Zfp365 A T 10: 67,909,856 C31S probably damaging Het
Zfp397 A T 18: 23,960,051 I198F possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp593 T C 4: 134,244,895 E100G possibly damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGAAGCTCCATGGTTGGG -3'
(R):5'- TAGAGTGACTGTGACTGACCCC -3'

Sequencing Primer
(F):5'- CTCCATGGTTGGGGGTAAG -3'
(R):5'- TGTGACTGACCCCACAGCTC -3'
Posted On2014-08-25