Incidental Mutation 'R0137:Nckap1l'
ID22065
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 038422-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R0137 (G1)
Quality Score191
Status Validated (trace)
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103481964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 721 (I721F)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably benign
Transcript: ENSMUST00000047405
AA Change: I721F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: I721F

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230276
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Phip G C 9: 82,927,191 probably null Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rccd1 A G 7: 80,320,578 V97A possibly damaging Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Scg3 A T 9: 75,663,180 probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
tentative UTSW 15 103474159 missense probably damaging 0.98
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0412:Nckap1l UTSW 15 103464652 missense probably benign 0.01
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
R7023:Nckap1l UTSW 15 103476066 missense probably benign 0.11
R7083:Nckap1l UTSW 15 103482124 missense probably damaging 1.00
R7360:Nckap1l UTSW 15 103476099 critical splice donor site probably null
R7361:Nckap1l UTSW 15 103471282 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCATTCTTGGCAGAAGTTGGGAC -3'
(R):5'- AGGAGGGCATTGCGAACGATTC -3'

Sequencing Primer
(F):5'- gaatcaaatgtcaatggacacaag -3'
(R):5'- TCTGGAAGCATCTGCACC -3'
Posted On2013-04-12