Incidental Mutation 'R2026:Avil'
ID220654
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Nameadvillin
SynonymsDOC6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R2026 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127000709-127020994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127011873 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 556 (G556S)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably damaging
Transcript: ENSMUST00000026500
AA Change: G556S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: G556S

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129173
AA Change: G556S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: G556S

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hif3a T C 7: 17,044,397 R437G possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr616 T A 7: 103,564,877 Y134F probably damaging Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pfas C T 11: 68,993,957 G473E probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 unclassified probably null
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R6838:Avil UTSW 10 127013562 missense probably benign
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGCACTCTGAAGGTCTGAACTC -3'
(R):5'- AGTGCATATGTGAGTGTACCTACG -3'

Sequencing Primer
(F):5'- AAGGTCTGAACTCTGCTTTTCAG -3'
(R):5'- ACCTACGTGTGTGTGTGCTC -3'
Posted On2014-08-25