Incidental Mutation 'R2026:Pfas'
ID220660
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2026 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68993957 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 473 (G473E)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: G473E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: G473E

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect unknown
Transcript: ENSMUST00000149703
AA Change: G27E
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899
AA Change: G27E

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152964
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,153,466 K269R probably benign Het
Abcc12 A G 8: 86,558,233 V251A probably benign Het
Avil G A 10: 127,011,873 G556S probably damaging Het
C3 T C 17: 57,218,562 Y898C probably damaging Het
Cacng2 A G 15: 77,995,520 F201L possibly damaging Het
Casp7 T A 19: 56,436,398 I183N probably damaging Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Ctrb1 T C 8: 111,688,685 N119S probably benign Het
Cyp3a59 G A 5: 146,096,288 V157M probably damaging Het
Dhfr G T 13: 92,365,771 G117* probably null Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dlg2 C A 7: 91,965,723 P290Q probably damaging Het
Dnah3 T A 7: 120,039,406 Q1240L probably damaging Het
Exd1 A T 2: 119,520,305 S492T probably benign Het
Fermt1 T C 2: 132,918,525 I415M probably benign Het
Fsip2 A G 2: 82,989,444 T5174A possibly damaging Het
Fuca2 T G 10: 13,512,647 V389G probably damaging Het
Gm14412 A T 2: 177,317,105 H50Q possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5129 G A 5: 29,735,734 probably benign Het
Hif3a T C 7: 17,044,397 R437G possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Hs1bp3 A G 12: 8,337,738 E301G probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ice2 T C 9: 69,416,325 S701P probably benign Het
Igf2bp1 A G 11: 95,974,170 V151A possibly damaging Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Man2b1 G C 8: 85,095,335 W726C probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Msh6 C T 17: 87,990,343 H1264Y probably damaging Het
Ncoa1 A T 12: 4,267,647 S1228R probably benign Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nutm2 A G 13: 50,474,820 H640R probably benign Het
Olfr1133 G T 2: 87,645,409 A238E probably damaging Het
Olfr1487 T A 19: 13,619,581 C140S probably damaging Het
Olfr266 T C 3: 106,821,711 I283V probably benign Het
Olfr31 T C 14: 14,328,891 V260A probably benign Het
Olfr616 T A 7: 103,564,877 Y134F probably damaging Het
Olfr801 T A 10: 129,670,465 D18V probably damaging Het
Pde1c C T 6: 56,180,190 V162I probably damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Polq A G 16: 37,062,745 D1757G possibly damaging Het
Popdc3 T C 10: 45,314,855 W21R probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rfc1 G T 5: 65,288,029 T412K probably damaging Het
Sap130 T C 18: 31,698,574 S706P possibly damaging Het
Scgn T C 13: 23,991,064 probably benign Het
Smad7 T C 18: 75,394,154 V357A probably damaging Het
Snrnp48 G T 13: 38,209,886 A56S possibly damaging Het
Sptbn1 G T 11: 30,104,559 A2178E probably benign Het
Syn2 C T 6: 115,278,251 T508I probably benign Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Trpm7 T C 2: 126,812,738 K1427E probably benign Het
Trrap A G 5: 144,803,044 I1118V possibly damaging Het
Tslp A T 18: 32,815,672 I37L probably benign Het
Ttll3 G A 6: 113,398,770 V297M probably damaging Het
Ttn T C 2: 76,710,369 D34091G possibly damaging Het
Txndc11 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 11,134,474 probably benign Het
Ube3a T C 7: 59,303,726 F803L probably damaging Het
Ubn1 A G 16: 5,064,650 E325G probably damaging Het
Wfikkn2 A G 11: 94,238,953 W121R possibly damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Zfp616 A T 11: 74,083,587 L227F possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- AGACCAAGCAGACTGAGTCC -3'
(R):5'- TTCCTTCCTTGCAGGCATGG -3'

Sequencing Primer
(F):5'- AAGCAGACTGAGTCCCTTGG -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2014-08-25